Gene Page: CEPT1

Summary
GeneID  10390
Symbol  CEPT1
Synonyms  DKFZp313G0615|MGC45223
Description  choline/ethanolamine phosphotransferase 1
See related  HGNC:24289|Ensembl:ENSG00000134255|HPRD:13024|
Locus tag  -
Gene type  protein-coding
Map location  1p13.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0235 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000287magnesium ion bindingIEA-
GO:0004142diacylglycerol cholinephosphotransferase activityIEA-
GO:0004307ethanolaminephosphotransferase activityTAS10191259 
GO:0016740transferase activityIEA-
GO:0016780phosphotransferase activity, for other substituted phosphate groupsIEA-
GO:0030145manganese ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006629lipid metabolic processTAS10191259 
GO:0008654phospholipid biosynthetic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005783endoplasmic reticulumIEA-
GO:0005789endoplasmic reticulum membraneIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneTAS10191259 
GO:0031965nuclear membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1867617671Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-323616622m8hsa-miR-323brainGCACAUUACACGGUCGACCUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.