Gene Page: CHD3

Summary
GeneID  1107
Symbol  CHD3
Synonyms  Mi-2a|Mi2-ALPHA|ZFH
Description  chromodomain helicase DNA binding protein 3
See related  HGNC:1918|MIM:602120|Ensembl:ENSG00000170004|HPRD:09071|
Locus tag  -
Gene type  protein-coding
Map location  17p13.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0278 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003677DNA bindingTAS9326634 
GO:0003682chromatin bindingIEA-
GO:0004003ATP-dependent DNA helicase activityTAS9326634 
GO:0005515protein bindingIPI12505151 |15383276 
GO:0005524ATP bindingIEA-
GO:0008270zinc ion bindingNAS9688266 
GO:0016787hydrolase activityIEA-
GO:0016818hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydridesIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006333chromatin assembly or disassemblyIEA-
GO:0006357regulation of transcription from RNA polymerase II promoterTAS9326634 
GO:0016568chromatin modificationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000785chromatinIEA-
GO:0005634nucleusNAS9688266 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ADH5ADH-3 | ADHX | FDH | GSNORalcohol dehydrogenase 5 (class III), chi polypeptideTwo-hybridBioGRID16169070 
ARS2ASR2 | MGC126427arsenate resistance protein 2Two-hybridBioGRID16169070 
ATPIF1ATPI | ATPIP | IP | MGC1167 | MGC8898ATPase inhibitory factor 1Two-hybridBioGRID16169070 
BCL6BCL5 | BCL6A | LAZ3 | ZBTB27 | ZNF51B-cell CLL/lymphoma 6BCL6 interacts with Mi2.BIND15454082 
BHLHB2DEC1 | SHARP-2 | STRA13 | Stra14 | bHLHe40basic helix-loop-helix domain containing, class B, 2Two-hybridBioGRID16169070 
C4orf17DKFZp434G072chromosome 4 open reading frame 17Two-hybridBioGRID16169070 
C7orf36GK003chromosome 7 open reading frame 36Two-hybridBioGRID16169070 
CASP6MCH2caspase 6, apoptosis-related cysteine peptidaseTwo-hybridBioGRID16169070 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidaseTwo-hybridBioGRID16169070 
CPE-carboxypeptidase ETwo-hybridBioGRID16169070 
CRCT1C1orf42 | NICE-1cysteine-rich C-terminal 1Two-hybridBioGRID16169070 
CREB1CREB | MGC9284cAMP responsive element binding protein 1Two-hybridBioGRID16169070 
CSTF2CstF-64cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDaTwo-hybridBioGRID16169070 
CTTNEMS1 | FLJ34459cortactinTwo-hybridBioGRID16169070 
FAM134AC2orf17 | DKFZp686C2379 | MGC3035family with sequence similarity 134, member ATwo-hybridBioGRID16169070 
FBP2MGC142192fructose-1,6-bisphosphatase 2Two-hybridBioGRID16169070 
FUBP1FBP | FUBPfar upstream element (FUSE) binding protein 1Two-hybridBioGRID16169070 
GPS2AMF-1 | MGC104294 | MGC119287 | MGC119288 | MGC119289G protein pathway suppressor 2Two-hybridBioGRID16169070 
HABP4IHABP4 | Ki-1/57 | MGC825 | SERBP1Lhyaluronan binding protein 4-HPRD,BioGRID12505151 
Ki-1/57 interacts with CHD-3.BIND12505151 
HDAC1DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1histone deacetylase 1-HPRD,BioGRID9804427 
HDAC2RPD3 | YAF1histone deacetylase 2-HPRD,BioGRID9804427 
HSPH1DKFZp686M05240 | HSP105 | HSP105A | HSP105B | KIAA0201 | NY-CO-25heat shock 105kDa/110kDa protein 1Two-hybridBioGRID16169070 
IKCSA2 | MGC59741 | REDIK cytokine, down-regulator of HLA IITwo-hybridBioGRID16169070 
IKZF1Hs.54452 | IK1 | IKAROS | LYF1 | PRO0758 | ZNFN1A1 | hIk-1IKAROS family zinc finger 1 (Ikaros)-HPRD10204490 
IKZF3AIO | AIOLOS | ZNFN1A3IKAROS family zinc finger 3 (Aiolos)-HPRD10204490 
IMMTDKFZp779P1653 | HMP | MGC111146 | P87 | P87/89 | P89 | PIG4 | PIG52inner membrane protein, mitochondrial (mitofilin)Two-hybridBioGRID16169070 
IVNS1ABPDKFZp686K06216 | FLARA3 | FLJ10069 | FLJ10411 | FLJ10962 | FLJ35593 | FLJ36593 | HSPC068 | KIAA0850 | ND1 | NS-1 | NS1-BP | NS1BPinfluenza virus NS1A binding proteinTwo-hybridBioGRID16169070 
KIF15FLJ25667 | HKLP2 | KNSL7 | NY-BR-62kinesin family member 15Two-hybridBioGRID16169070 
LUC7L2CGI-59 | CGI-74 | FLJ10657 | LUC7B2LUC7-like 2 (S. cerevisiae)Two-hybridBioGRID16169070 
MAFGMGC13090 | MGC20149v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)Two-hybridBioGRID16169070 
MAN2A2MANA2Xmannosidase, alpha, class 2A, member 2Two-hybridBioGRID16169070 
MBD2DKFZp586O0821 | DMTase | NY-CO-41methyl-CpG binding domain protein 2Reconstituted ComplexBioGRID10444591 
MBD3L1MBD3L | MGC138263 | MGC138269methyl-CpG binding domain protein 3-like 1Affinity Capture-WesternBioGRID15456747 
MTA2DKFZp686F2281 | MTA1L1 | PIDmetastasis associated 1 family, member 2Co-purificationBioGRID10444591 
PAICSADE2 | ADE2H1 | AIRC | DKFZp781N1372 | MGC1343 | MGC5024 | PAISphosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetaseTwo-hybridBioGRID16169070 
PCMT1-protein-L-isoaspartate (D-aspartate) O-methyltransferaseTwo-hybridBioGRID16169070 
PRG2BMPG | MBP | MBP1 | MGC14537proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)Two-hybridBioGRID16169070 
PRPF40AFBP-11 | FBP11 | FLAF1 | FLJ20585 | FNBP3 | HIP10 | HYPA | NY-REN-6PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)-HPRD15383276 
PSME1IFI5111 | MGC8628 | PA28A | PA28alpha | REGalphaproteasome (prosome, macropain) activator subunit 1 (PA28 alpha)Two-hybridBioGRID16169070 
PTNHARP | HBGF8 | HBNF | NEGF1pleiotrophinTwo-hybridBioGRID16169070 
PTPRSPTPSIGMAprotein tyrosine phosphatase, receptor type, STwo-hybridBioGRID16169070 
PUF60FIR | FLJ31379 | RoBPI | SIAHBP1poly-U binding splicing factor 60KDaTwo-hybridBioGRID16169070 
RAD21FLJ25655 | FLJ40596 | HR21 | HRAD21 | KIAA0078 | MCD1 | NXP1 | SCC1 | hHR21RAD21 homolog (S. pombe)Co-purificationBioGRID12198550 
RAD51BRCC5 | HRAD51 | HsRad51 | HsT16930 | RAD51A | RECARAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)Two-hybridBioGRID16169070 
RPL29HIP | HUMRPL29 | MGC88589ribosomal protein L29Two-hybridBioGRID16169070 
SAFBDKFZp779C1727 | HAP | HET | SAFB1scaffold attachment factor BTwo-hybridBioGRID16169070 
SAT1DC21 | KFSD | SAT | SSAT | SSAT-1spermidine/spermine N1-acetyltransferase 1Two-hybridBioGRID16169070 
SATB1-SATB homeobox 1-HPRD12374985 
SDCCAG3NY-CO-3serologically defined colon cancer antigen 3Two-hybridBioGRID16169070 
SERBP1CGI-55 | CHD3IP | DKFZp564M2423 | FLJ90489 | HABP4L | PAI-RBP1 | PAIRBP1SERPINE1 mRNA binding protein 1-HPRD,BioGRID12505151 
CGI-55 interacts with CHD-3.BIND12505151 
SERF24F5REL | FAM2C | FLJ20431 | FLJ37527 | FLJ38557 | H4F5rel | HsT17089 | MGC48826small EDRK-rich factor 2Two-hybridBioGRID16169070 
SGSM2KIAA0397 | RUTBC1small G protein signaling modulator 2Two-hybridBioGRID16169070 
SIRT6SIR2L6sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)Two-hybridBioGRID16169070 
SLC27A6ACSVL2 | DKFZp779M0564 | FACVL2 | FATP6 | VLCS-H1solute carrier family 27 (fatty acid transporter), member 6Two-hybridBioGRID16169070 
SMARCA5ISWI | SNF2H | WCRF135 | hISWI | hSNF2HSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5Co-purificationBioGRID12198550 
SUMO1DAP-1 | GMP1 | OFC10 | PIC1 | SENP2 | SMT3 | SMT3C | SMT3H3 | SUMO-1 | UBL1SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)SUMO-1 interacts with CHD3.BIND14609633 
-HPRD14609633 
Two-hybridBioGRID10961991 
SUMO2HSMT3 | MGC117191 | SMT3B | SMT3H2SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)Two-hybridBioGRID16169070 
THOC7FLJ23445 | NIF3L1BP1 | fSAP24THO complex 7 homolog (Drosophila)Two-hybridBioGRID16169070 
TNFRSF14ATAR | HVEA | HVEM | LIGHTR | TR2tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)Two-hybridBioGRID16169070 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD,BioGRID10961991 
TP73P73tumor protein p73-HPRD,BioGRID10961991 
TRIM28FLJ29029 | KAP1 | RNF96 | TF1B | TIF1Btripartite motif-containing 28Two-hybridBioGRID16169070 
TSPAN6T245 | TM4SF6 | TSPAN-6tetraspanin 6Two-hybridBioGRID16169070 
TTRHsT2651 | PALB | TBPAtransthyretinTwo-hybridBioGRID16169070 
TXNDC9APACDthioredoxin domain containing 9Two-hybridBioGRID16169070 
UBA3DKFZp566J164 | MGC22384 | UBE1C | hUBA3ubiquitin-like modifier activating enzyme 3Two-hybridBioGRID16169070 
UBE2IC358B7.1 | P18 | UBC9ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)-HPRD,BioGRID14609633 
Ubc9 interacts with CHD3.BIND14609633 
XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4Two-hybridBioGRID16169070 
ZHX1-zinc fingers and homeoboxes 1-HPRD15383276 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4919096m8hsa-miR-491brainAGUGGGGAACCCUUCCAUGAGGA
miR-504252258m8hsa-miR-504AGACCCUGGUCUGCACUCUAU
miR-72562631A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.