Gene Page: CHST14

Summary
GeneID  113189
Symbol  CHST14
Synonyms  D4ST-1|D4ST1|HD4ST|HNK1ST
Description  carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
See related  HGNC:24464|Ensembl:ENSG00000169105|HPRD:16780|
Locus tag  -
Gene type  protein-coding
Map location  15q15.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
ExpressionExpressionP value: 3.326 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001537N-acetylgalactosamine 4-O-sulfotransferase activityIDA11470797 
GO:0005515protein bindingIEA-
GO:0016740transferase activityIEA-
GO:0042301phosphate bindingNAS11470797 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0005975carbohydrate metabolic processIEA-
GO:0050655dermatan sulfate proteoglycan metabolic processIDA11470797 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneNAS11470797 
 
KEGG Pathway Info
hsa00532: Chondroitin sulfate biosynthesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa01030: Glycan structures - biosynthesis 1 - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-95935991Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.