Gene Page: CNP

Summary
GeneID  1267
Symbol  CNP
Synonyms  CNP1
Description  2',3'-cyclic nucleotide 3' phosphodiesterase
See related  HGNC:2158|MIM:123830|Ensembl:ENSG00000173786|HPRD:00448|
Locus tag  -
Gene type  protein-coding
Map location  17q21
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:00041132',3'-cyclic-nucleotide 3'-phosphodiesterase activityTAS8392017 
GO:0016787hydrolase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)1322358 
GO:0007409axonogenesisIEAneuron, axon, neurite (GO term level: 12)-
GO:0008344adult locomotory behaviorIEA-
GO:0009214cyclic nucleotide catabolic processIEA-
GO:0016070RNA metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005615extracellular spaceIDA12379507 
GO:0005622intracellularIEA-
GO:0005624membrane fractionIEA-
GO:0005737cytoplasmIDA12379507 
GO:0016020membraneIEA-
GO:0042470melanosomeIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
TUBA1AB-ALPHA-1 | FLJ25113 | LIS3 | TUBA3tubulin, alpha 1a-HPRD11842207 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a14031409m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-338373837451A,m8hsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-3782242301Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-544142514311Ahsa-miR-544AUUCUGCAUUUUUAGCAAGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.