Gene Page: MAP3K8

Summary
GeneID  1326
Symbol  MAP3K8
Synonyms  COT|EST|ESTF|FLJ10486|TPL2|Tpl-2|c-COT
Description  mitogen-activated protein kinase kinase kinase 8
See related  HGNC:6860|MIM:191195|Ensembl:ENSG00000107968|HPRD:01863|
Locus tag  RP11-449I17.8
Gene type  protein-coding
Map location  10p11.23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0333 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0000287magnesium ion bindingIEA-
GO:0004672protein kinase activityIEA-
GO:0004674protein serine/threonine kinase activityTAS8226782 
GO:0004709MAP kinase kinase kinase activityIEA-
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI15169888 
GO:0005524ATP bindingIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIEA-
GO:0006468protein amino acid phosphorylationTAS2072910 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005829cytosolTAS8226782 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKT1AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHAv-akt murine thymoma viral oncogene homolog 1-HPRD,BioGRID12138205 
CHUKIKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16conserved helix-loop-helix ubiquitous kinase-HPRD,BioGRID10072079 
KSR2FLJ25965kinase suppressor of ras 2Affinity Capture-WesternBioGRID12975377 
MAP2K1MAPKK1 | MEK1 | MKK1 | PRKMK1mitogen-activated protein kinase kinase 1Biochemical ActivityBioGRID8631303 
MAP2K4JNKK | JNKK1 | MAPKK4 | MEK4 | MKK4 | PRKMK4 | SEK1 | SERK1mitogen-activated protein kinase kinase 4-HPRD,BioGRID8631303 
MAP3K14FTDCR1B | HS | HSNIK | NIKmitogen-activated protein kinase kinase kinase 14-HPRD,BioGRID10072079 
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1-HPRD,BioGRID9950430 
NFKB2LYT-10 | LYT10nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)Affinity Capture-MSBioGRID14743216 
RELC-Relv-rel reticuloendotheliosis viral oncogene homolog (avian)Affinity Capture-MSBioGRID14743216 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)Affinity Capture-MSBioGRID14743216 
TNIP2ABIN-2 | ABIN2 | FLIP1 | KLIP | MGC4289TNFAIP3 interacting protein 2-HPRD,BioGRID14743216 |15169888 
TRAF2MGC:45012 | TRAP | TRAP3TNF receptor-associated factor 2-HPRD,BioGRID11932422 
 
KEGG Pathway Info
hsa04010: MAPK signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04620: Toll-like receptor signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04660: T cell receptor signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1406806871A,m8hsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-1461992051Ahsa-miR-146aUGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrainUGAGAACUGAAUUCCAUAGGCU
miR-17-5p/20/93.mr/106/519.d286292m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-299-3p6836891Ahsa-miR-299-3pUAUGUGGGAUGGUAAACCGCUU
miR-299-5p6786851A,m8hsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-370567573m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-5392052121A,m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.