Gene Page: CSNK2A1

Summary
GeneID  1457
Symbol  CSNK2A1
Synonyms  CK2A1|CKII
Description  casein kinase 2, alpha 1 polypeptide
See related  HGNC:2457|MIM:115440|Ensembl:ENSG00000101266|HPRD:00277|
Locus tag  -
Gene type  protein-coding
Map location  20p13
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.6661 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0004674protein serine/threonine kinase activityIEA-
GO:0004674protein serine/threonine kinase activityTAS2174700 
GO:0005524ATP bindingIEA-
GO:0008013beta-catenin bindingIEA-
GO:0016740transferase activityIEA-
GO:0019888protein phosphatase regulator activityIEA-
GO:0047485protein N-terminus bindingIPI11972058 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIEA-
GO:0006468protein amino acid phosphorylationTAS2174700 
GO:0007165signal transductionTAS2174700 
GO:0016055Wnt receptor signaling pathwayIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS10799509 
GO:0005886plasma membraneTAS10799509 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKT1AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHAv-akt murine thymoma viral oncogene homolog 1CK2 interacts with and phosphorylates Akt. This interaction was modeled on a demonstrated interaction between human CK2 and Akt from an unspecified species and mouse.BIND15818404 
APCBTPS2 | DP2 | DP2.5 | DP3 | GSadenomatous polyposis coliAffinity Capture-Western
Reconstituted Complex
BioGRID11972058 
ARR3ARRXarrestin 3, retinal (X-arrestin)-HPRD,BioGRID11877451 
ARRB1ARB1 | ARR1arrestin, beta 1Affinity Capture-MSBioGRID17353931 
ATF1EWS-ATF1 | FUS/ATF-1 | TREB36activating transcription factor 1-HPRD,BioGRID9685505 
ATF2CRE-BP1 | CREB2 | HB16 | MGC111558 | TREB7activating transcription factor 2-HPRD,BioGRID9685505 
BDP1DKFZp686C01233 | DKFZp686K0831 | HSA238520 | KIAA1241 | KIAA1689 | TAF3B1 | TFC5 | TFIIIB'' | TFIIIB150 | TFIIIB90 | TFNRB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIBCK2alpha interacts with Bdp1.BIND15469824 
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onset-HPRD,BioGRID10403822 
BRF1BRF | FLJ42674 | FLJ43034 | GTF3B | MGC105048 | TAF3B2 | TAF3C | TAFIII90 | TF3B90 | TFIIIB90 | hBRFBRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)-HPRD,BioGRID11997511 
CDC25B-cell division cycle 25 homolog B (S. pombe)Affinity Capture-Western
Biochemical Activity
Reconstituted Complex
BioGRID12527891 
CDKN1ACAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1cyclin-dependent kinase inhibitor 1A (p21, Cip1)-HPRD11255227 
CFDP1BCNT | BUCENTAUR | CP27 | SWC5 | Yeti | p97craniofacial development protein 1-HPRD10350657 
CHEK1CHK1CHK1 checkpoint homolog (S. pombe)Affinity Capture-Western
Reconstituted Complex
BioGRID12902976 |15225637 
CREBBPCBP | KAT3A | RSTSCREB binding protein-HPRD,BioGRID9685505 
CSNK2BCK2B | CK2N | CSK2B | G5A | MGC138222 | MGC138224casein kinase 2, beta polypeptideInteraction between CK2-beta subunit (PDB ID: 1JWH_D) and CK2-alpha subunit (PDB ID: 1JWH_A).BIND11092945 |11574463 
Interaction between CK2-beta subunit (PDB ID: 1JWH_C) and CK2-alpha subunit (PDB ID: 1JWH_B).BIND11092945 |11574463 
Interaction between CK2-beta subunit (PDB ID: 1JWH_D) and CK2-alpha subunit (PDB ID: 1JWH_B).BIND11092945 |11574463 
-HPRD,BioGRID9188720 |9571630 
Interaction between CK2-beta subunit (PDB ID: 1JWH_C) and CK2-alpha subunit (PDB ID: 1JWH_A).BIND11092945 |11574463 
CK2-alpha subunit interacts with CK2-beta subunit.BIND7768894 
CTNNB1CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923catenin (cadherin-associated protein), beta 1, 88kDa-HPRD12432063 
DDIT3CEBPZ | CHOP | CHOP10 | GADD153 | MGC4154DNA-damage-inducible transcript 3-HPRD,BioGRID12876286 
DVL1DVL | MGC54245dishevelled, dsh homolog 1 (Drosophila)-HPRD,BioGRID10806215 
DVL2-dishevelled, dsh homolog 2 (Drosophila)Affinity Capture-WesternBioGRID10806215 
DVL3KIAA0208dishevelled, dsh homolog 3 (Drosophila)-HPRD,BioGRID10806215 
EEF1DEF-1D | EF1D | FLJ20897 | FP1047eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)-HPRD,BioGRID10094407 
EIF2S2DKFZp686L18198 | EIF2 | EIF2B | EIF2beta | MGC8508eukaryotic translation initiation factor 2, subunit 2 beta, 38kDaEIF2beta interacts with CK2alpha.BIND12901717 
FGF1AFGF | ECGF | ECGF-beta | ECGFA | ECGFB | FGF-alpha | FGFA | GLIO703 | HBGF1fibroblast growth factor 1 (acidic)-HPRD,BioGRID12145206 
FGF2BFGF | FGFB | HBGF-2fibroblast growth factor 2 (basic)-HPRD,BioGRID12145206 
FIBPFGFIBP | FIBP-1fibroblast growth factor (acidic) intracellular binding protein-HPRD12145206 
FLGATOD2filaggrin-HPRD8270625 
FOSAP-1 | C-FOSv-fos FBJ murine osteosarcoma viral oncogene homolog-HPRD,BioGRID9685505 
GABRR2-gamma-aminobutyric acid (GABA) receptor, rho 2-HPRD12175859 
GDNFATF1 | ATF2 | HFB1-GDNFglial cell derived neurotrophic factor-HPRD9685505 
HCLS1CTTNL | HS1hematopoietic cell-specific Lyn substrate 1Biochemical ActivityBioGRID11988074 
HDAC2RPD3 | YAF1histone deacetylase 2-HPRD,BioGRID12176973 
HDAC3HD3 | RPD3 | RPD3-2histone deacetylase 3CSNK2A1 (CK2) phosphorylates HDAC3.BIND15805470 
HNRNPA2B1DKFZp779B0244 | FLJ22720 | HNRNPA2 | HNRNPB1 | HNRPA2 | HNRPA2B1 | HNRPB1 | RNPA2 | SNRPB1heterogeneous nuclear ribonucleoprotein A2/B1-HPRD,BioGRID10381337 
HSP90AA1FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2heat shock protein 90kDa alpha (cytosolic), class A member 1-HPRD,BioGRID7794926 
HSP90B1ECGP | GP96 | GRP94 | TRA1heat shock protein 90kDa beta (Grp94), member 1-HPRD,BioGRID11557039 
IRF1IRF-1 | MARinterferon regulatory factor 1An unspecified isoform of CK2-alpha interacts with IRF-1 promoter.BIND15893730 
IRF2DKFZp686F0244 | IRF-2interferon regulatory factor 2-HPRD,BioGRID9213219 
JUNAP-1 | AP1 | c-Junjun oncogene-HPRD,BioGRID9685505 
KLF1EKLFKruppel-like factor 1 (erythroid)-HPRD,BioGRID9722526 
MAPK14CSBP1 | CSBP2 | CSPB1 | EXIP | Mxi2 | PRKM14 | PRKM15 | RK | SAPK2A | p38 | p38ALPHAmitogen-activated protein kinase 14Affinity Capture-Western
Reconstituted Complex
BioGRID10747897 
MAZPUR1 | Pur-1 | SAF-1 | SAF-2 | ZF87 | ZNF801 | Zif87MYC-associated zinc finger protein (purine-binding transcription factor)Biochemical ActivityBioGRID10448092 
MGMT-O-6-methylguanine-DNA methyltransferase-HPRD,BioGRID10667577 
MMECALLA | CD10 | DKFZp686O16152 | MGC126681 | MGC126707 | NEPmembrane metallo-endopeptidaseBiochemical ActivityBioGRID8943850 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)CK2 interacts with and phosphorylates c-Myc. This interaction was modelled on a demonstrated interaction between mouse CK2 and human c-Myc.BIND12149649 
NAP1L4MGC4565 | NAP2 | NAP2L | hNAP2nucleosome assembly protein 1-like 4-HPRD10764593 
NCLC23 | FLJ45706nucleolin-HPRD2192260|8663258 
OGTFLJ23071 | HRNT1 | MGC22921 | O-GLCNACO-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)-HPRD10753899 
PAFAH1B1LIS1 | LIS2 | MDCR | MDS | PAFAHplatelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa-HPRD,BioGRID10491172 
PAK1MGC130000 | MGC130001 | PAKalphap21 protein (Cdc42/Rac)-activated kinase 1-HPRD10938077 
PIN1DOD | UBL5peptidylprolyl cis/trans isomerase, NIMA-interacting 1-HPRD,BioGRID11940573 
PLEKHO1CKIP-1 | OC120pleckstrin homology domain containing, family O member 1-HPRD,BioGRID10799509 
PPP2R4MGC2184 | PP2A | PR53 | PTPAprotein phosphatase 2A activator, regulatory subunit 4-HPRD9139659 
PRNPASCR | CD230 | CJD | GSS | MGC26679 | PRIP | PrP | PrP27-30 | PrP33-35C | PrPc | prionprion proteinPrPc interacts with CSNK2A1 (CK2 alpha). This interaction was modeled on a demonstrated interaction between bovine PrPc and human CSNK2A1 (CK2 alpha).BIND11062072 
PSMA4HC9 | HsT17706 | MGC111191 | MGC12467 | MGC24813 | PSC9proteasome (prosome, macropain) subunit, alpha type, 4-HPRD,BioGRID8619999 
PTEN10q23del | BZS | MGC11227 | MHAM | MMAC1 | PTEN1 | TEP1phosphatase and tensin homolog-HPRD,BioGRID12297295 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)-HPRD,BioGRID10938077 
RNPS1E5.1 | MGC117332RNA binding protein S1, serine-rich domainAffinity Capture-MSBioGRID17353931 
RPL5MGC117339 | MSTP030ribosomal protein L5-HPRD,BioGRID10491318 
RPS6KB1PS6K | S6K | S6K1 | STK14A | p70(S6K)-alpha | p70-S6K | p70-alpharibosomal protein S6 kinase, 70kDa, polypeptide 1Reconstituted ComplexBioGRID16895915 
SFNYWHASstratifinAffinity Capture-MSBioGRID15778465 
SFRS12DKFZp564B176 | MGC133045 | SRrp508 | SRrp86splicing factor, arginine/serine-rich 12-HPRD14559993 
SPI1OF | PU.1 | SFPI1 | SPI-1 | SPI-Aspleen focus forming virus (SFFV) proviral integration oncogene spi1Biochemical ActivityBioGRID8632909 
SPIBSPI-BSpi-B transcription factor (Spi-1/PU.1 related)-HPRD,BioGRID8632909 
TAF7TAF2F | TAFII55TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDaCK2-alpha interacts with TAF7 promoter.BIND15893730 
TOP1TOPItopoisomerase (DNA) I-HPRD,BioGRID2998765 
UBTFNOR-90 | UBFupstream binding transcription factor, RNA polymerase I-HPRD,BioGRID7651819 
VAMP4VAMP24vesicle-associated membrane protein 4Biochemical ActivityBioGRID14608369 
XKKX | X1k | XKR1X-linked Kx blood group (McLeod syndrome)-HPRD,BioGRID9647734 
XKRYXKRY1XK, Kell blood group complex subunit-related, Y-linkedBiochemical ActivityBioGRID9647734 
YWHABGW128 | HS1 | KCIP-1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptideAffinity Capture-MSBioGRID17353931 
ZHX1-zinc fingers and homeoboxes 1Two-hybridBioGRID16169070 
 
KEGG Pathway Info
hsa04310: Wnt signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04520: Adherens junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04530: Tight junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/351212218m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-141/200a12191225m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-18612291235m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-23120712131Ahsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-30-3p2252311Ahsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-3264254311Ahsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-329117611821Ahsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-3312142201Ahsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-3753063121Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-411102108m8hsa-miR-411AACACGGUCCACUAACCCUCAGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.