Gene Page: DARS

Summary
GeneID  1615
Symbol  DARS
Synonyms  DKFZp781B11202|MGC111579
Description  aspartyl-tRNA synthetase
See related  HGNC:2678|MIM:603084|Ensembl:ENSG00000115866|HPRD:04361|
Locus tag  -
Gene type  protein-coding
Map location  2q21.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.023 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.02395 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003676nucleic acid bindingIEA-
GO:0004046aminoacylase activityTAS8449960 
GO:0004815aspartate-tRNA ligase activityTAS8449960 
GO:0005515protein bindingIPI17220478 
GO:0005524ATP bindingIEA-
GO:0016874ligase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006422aspartyl-tRNA aminoacylationTAS8449960 
GO:0006461protein complex assemblyTAS8449960 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005625soluble fractionTAS8449960 
GO:0005737cytoplasmTAS8449960 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EEF1A1CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1eukaryotic translation elongation factor 1 alpha 1-HPRD,BioGRID7806521 
EEF1DEF-1D | EF1D | FLJ20897 | FP1047eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)DRS interacts with unspecified isoform of EF-1-delta.BIND11829477 
JTV1AIMP2 | P38 | PRO0992JTV1 geneTwo-hybridBioGRID16189514 
MAP3K7TAK1 | TGF1amitogen-activated protein kinase kinase kinase 7-HPRD14743216 
MARSFLJ35667 | METRS | MTRNSmethionyl-tRNA synthetase-HPRD1651330 |9878398 
 
KEGG Pathway Info
hsa00252: Alanine and aspartate metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00970: Aminoacyl-tRNA biosynthesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3842462521Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.