Gene Page: DRD2

Summary
GeneID  1813
Symbol  DRD2
Synonyms  D2DR|D2R
Description  dopamine receptor D2
See related  HGNC:3023|MIM:126450|Ensembl:ENSG00000149295|HPRD:00539|
Locus tag  -
Gene type  protein-coding
Map location  11q23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies3Link to SZGene
GSMA_Igenome scan meta-analysisPsr: 0.006 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenia, schizophrenias, schizophrenic]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 16 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 31 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001670dopamine D2 receptor activityIDAdopamine (GO term level: 10)8301582 
GO:0004872receptor activityIEA-
GO:0004952dopamine receptor activityIEANeurotransmitter, dopamine (GO term level: 8)-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001659temperature homeostasisISS-
GO:0001975response to amphetamineISS-
GO:0001976regulation of systemic arterial blood pressure by neurological processISS-
GO:0002027regulation of heart rateISS-
GO:0002028regulation of sodium ion transportISS-
GO:0002052positive regulation of neuroblast proliferationISS-
GO:0007165signal transductionIEA-
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
GO:0007270nerve-nerve synaptic transmissionISSneuron, Synap (GO term level: 7)-
GO:0007409axonogenesisISSneuron, axon, neurite (GO term level: 12)-
GO:0007416synaptogenesisISSSynap (GO term level: 6)-
GO:0007608sensory perception of smellISS-
GO:0007626locomotory behaviorISS-
GO:0007628adult walking behaviorISS-
GO:0008104protein localizationISS-
GO:0008285negative regulation of cell proliferationISS-
GO:0008306associative learningISS-
GO:0008542visual learningISS-
GO:0009416response to light stimulusISS-
GO:0021853cerebral cortex GABAergic interneuron migrationISSneuron, GABA (GO term level: 14)-
GO:0021984adenohypophysis developmentISS-
GO:0030146diuresisISS-
GO:0030147natriuresisISS-
GO:0030336negative regulation of cell migrationISS-
GO:0030384phosphoinositide metabolic processISS-
GO:0030432peristalsisISS-
GO:0030814regulation of cAMP metabolic processIDA8666994 
GO:0032228regulation of synaptic transmission, GABAergicISSneuron, GABA, Synap, Neurotransmitter (GO term level: 9)-
GO:0032922circadian regulation of gene expressionISS-
GO:0042417dopamine metabolic processICNeurotransmitter, dopamine (GO term level: 8)8301582 
GO:0042493response to drugISS-
GO:0043266regulation of potassium ion transportISS-
GO:0043278response to morphineISS-
GO:0045776negative regulation of blood pressureISS-
GO:0048148behavioral response to cocaineISS-
GO:0048149behavioral response to ethanolISS-
GO:0048169regulation of long-term neuronal synaptic plasticityISSneuron, Synap (GO term level: 10)-
GO:0048755branching morphogenesis of a nerveISSneuron (GO term level: 6)-
GO:0050482arachidonic acid secretionIDA8301582 
GO:0050709negative regulation of protein secretionIDA16839358 
GO:0051209release of sequestered calcium ion into cytosolISS-
GO:0051586positive regulation of dopamine uptakeISSdopamine (GO term level: 12)-
GO:0051898negative regulation of protein kinase B signaling cascadeISS-
GO:0051967negative regulation of synaptic transmission, glutamatergicISSneuron, glutamate, Synap, Neurotransmitter (GO term level: 10)-
GO:0060124positive regulation of growth hormone secretionISS-
GO:0060134prepulse inhibitionISS-
GO:0060158dopamine receptor, phospholipase C activating pathwayIGIdopamine (GO term level: 10)17194762 
GO:0060160negative regulation of dopamine receptor signaling pathwayISSdopamine (GO term level: 10)-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneIEA-
GO:0016021integral to membraneIEA-
GO:0030424axonISSneuron, axon, Neurotransmitter (GO term level: 6)-
GO:0030425dendriteISSneuron, axon, dendrite (GO term level: 6)-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ADORA2AADORA2 | RDC8 | hA2aRadenosine A2a receptor-HPRD,BioGRID12804599 
CLIC6CLIC1Lchloride intracellular channel 6-HPRD,BioGRID14499480 
DRD2D2DR | D2Rdopamine receptor D2D2S receptors form homodimers through Cys126 in the fourth transmembrane segment.BIND12496294 
EPB414.1R | EL1 | HEerythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)-HPRD12181426 
EPB41L14.1N | DKFZp686H17242 | KIAA0338 | MGC11072erythrocyte membrane protein band 4.1-like 1-HPRD,BioGRID12181426 
FLNAABP-280 | ABPX | DKFZp434P031 | FLN | FLN1 | FMD | MNS | NHBP | OPD | OPD1 | OPD2filamin A, alpha (actin binding protein 280)Affinity Capture-WesternBioGRID12181426 
Dopamine receptor D2 interacts with filamin A. This interaction was modeled on a demonstrated interaction between human FLN-A and D2 from unspecified source.BIND11320256 
-HPRD11911837 
FREQDKFZp761L1223 | FLUP | NCS-1 | NCS1frequenin homolog (Drosophila)-HPRD,BioGRID12351722 
The D2 dopamine receptor interacts with NCS-1.BIND12351722 
GNAI2GIP | GNAI2B | H_LUCA15.1 | H_LUCA16.1guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2-HPRD10978845 
GNAI387U6 | FLJ26559guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3-HPRD10978845 
GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide-HPRD9166747 
KCNJ3GIRK1 | KGA | KIR3.1potassium inwardly-rectifying channel, subfamily J, member 3Affinity Capture-WesternBioGRID12297500 
KCNJ5CIR | GIRK4 | KATP1 | KIR3.4potassium inwardly-rectifying channel, subfamily J, member 5Affinity Capture-WesternBioGRID12297500 
KCNJ6BIR1 | GIRK2 | KATP2 | KCNJ7 | KIR3.2 | MGC126596 | hiGIRK2potassium inwardly-rectifying channel, subfamily J, member 6-HPRD,BioGRID12297500 
KCNJ9GIRK3 | KIR3.3potassium inwardly-rectifying channel, subfamily J, member 9-HPRD12297500 
PPP1R9BFLJ30345 | PPP1R6 | PPP1R9 | SPINO | Spnprotein phosphatase 1, regulatory (inhibitor) subunit 9B-HPRD,BioGRID10391935 
SSTR5-somatostatin receptor 5-HPRD10753124 
 
KEGG Pathway Info
hsa04080: Neuroactive ligand-receptor interaction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04540: Gap junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a128134m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-2149789841Ahsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-3265275341A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-92892961A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.