Gene Page: ATN1

Summary
GeneID  1822
Symbol  ATN1
Synonyms  B37|D12S755E|DRPLA|NOD
Description  atrophin 1
See related  HGNC:3033|MIM:607462|Ensembl:ENSG00000111676|HPRD:06311|
Locus tag  -
Gene type  protein-coding
Map location  12p13.31
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.2088 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003714transcription corepressor activityIEA-
GO:0005515protein bindingIEA-
GO:0019904protein domain specific bindingIPI11984006 
GO:0050827toxin receptor bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000122negative regulation of transcription from RNA polymerase II promoterIEA-
GO:0007417central nervous system developmentTASBrain (GO term level: 6)7647802 
GO:0008219cell deathIEA-
GO:0009404toxin metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS10814707 
GO:0005737cytoplasmIEA-
GO:0005737cytoplasmTAS7647802 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ATRXATR2 | MGC2094 | MRXHF1 | RAD54 | RAD54L | SFM1 | SHS | XH2 | XNP | ZNF-HXalpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)-HPRD14645126 
BAIAP2BAP2 | IRSP53BAI1-associated protein 2-HPRD,BioGRID10332026 
CASP1ICE | IL1BC | P45caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)Atrophin-1 interacts with caspase 1. This interaction was modeled on a demonstrated interaction between human atrophin-1 and caspase 1 from an unspecified species.BIND9535906 
CASP3CPP32 | CPP32B | SCA-1caspase 3, apoptosis-related cysteine peptidaseAtrophin-1 interacts with caspase 3. This interaction was modeled on a demonstrated interaction between human atrophin-1 and caspase 3 from an unspecified species.BIND9535906 
CASP7CMH-1 | ICE-LAP3 | MCH3caspase 7, apoptosis-related cysteine peptidaseAtrophin-1 interacts with caspase 7.BIND9535906 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidaseAtrophin-1 interacts with caspase 8.BIND9535906 
CTNND2GT24 | NPRAPcatenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)Two-hybridBioGRID10332026 
DVL1DVL | MGC54245dishevelled, dsh homolog 1 (Drosophila)Two-hybridBioGRID10332026 
ITCHAIF4 | AIP4 | NAPP1 | dJ468O1.1itchy E3 ubiquitin protein ligase homolog (mouse)-HPRD,BioGRID9647693 
Atrophin-1 interacts with AIP4.BIND9647693 
LYSTCHS | CHS1lysosomal trafficking regulator-HPRD,BioGRID11984006 
MAGI1AIP3 | BAIAP1 | BAP1 | MAGI-1 | TNRC19 | WWP3membrane associated guanylate kinase, WW and PDZ domain containing 1Atrophin-1 interacts with AIP-3.BIND9647693 
-HPRD,BioGRID9647693 
MAGI2ACVRIP1 | AIP1 | ARIP1 | MAGI-2 | SSCAMmembrane associated guanylate kinase, WW and PDZ domain containing 2Atrophin-1 interacts with AIP1.BIND9647693 
-HPRD9647693 
MYST2HBO1 | HBOA | KAT7MYST histone acetyltransferase 2Two-hybridBioGRID16169070 
PDCD6IPAIP1 | Alix | DRIP4 | HP95 | MGC17003programmed cell death 6 interacting protein-HPRD,BioGRID9647693 
REREARG | ARP | ATN1L | DNB1 | FLJ38775 | KIAA0458arginine-glutamic acid dipeptide (RE) repeats-HPRD,BioGRID10814707 
TLE1ESG | ESG1 | GRG1transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)Two-hybridBioGRID16169070 
VIMFLJ36605vimentinTwo-hybridBioGRID16169070 
WWP1AIP5 | DKFZp434D2111 | Tiul1 | hSDRP1WW domain containing E3 ubiquitin protein ligase 1-HPRD,BioGRID9647693 
Atrophin-1 interacts with AIP-5.BIND9647693 
WWP2AIP2 | WWp2-likeWW domain containing E3 ubiquitin protein ligase 2Atrophin-1 interacts with AIP2.BIND9647693 
-HPRD,BioGRID9647693 
 
KEGG Pathway Info
hsa05050: Dentatorubropallidoluysian atrophy (DRPLA) - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4104534591Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.