Gene Page: EFNB1

Summary
GeneID  1947
Symbol  EFNB1
Synonyms  CFND|CFNS|EFL3|EPLG2|Elk-L|LERK2|MGC8782
Description  ephrin-B1
See related  HGNC:3226|MIM:300035|Ensembl:ENSG00000090776|HPRD:02072|
Locus tag  RP3-496G1.1
Gene type  protein-coding
Map location  Xq12
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0172 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI9883737 
GO:0005515protein bindingISS-
GO:0046875ephrin receptor bindingTAS8798744 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001755neural crest cell migrationIEA-
GO:0007155cell adhesionTAS8798744 
GO:0007267cell-cell signalingTAS8798744 
GO:0007275multicellular organismal developmentIEA-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0007411axon guidanceIEAaxon (GO term level: 13)-
GO:0009880embryonic pattern specificationIEA-
GO:0030154cell differentiationIEA-
GO:0042102positive regulation of T cell proliferationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005625soluble fractionTAS8798744 
GO:0005887integral to plasma membraneTAS8660976 
GO:0016020membraneIEA-
GO:0045121membrane raftIEA-
GO:0045202synapseISSneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EPHA3ETK | ETK1 | HEK | HEK4 | TYRO4EPH receptor A3Reconstituted ComplexBioGRID9195962 
EPHB1ELK | EPHT2 | FLJ37986 | Hek6 | NETEPH receptor B1The membrane bound ligand ELK-L interacts with the receptor ELK. This interaction was modeled on a demonstrated interaction between ELK-L from human and ELK from rat.BIND7973638 |8755474 
-HPRD,BioGRID10669731 |12223469 
EPHB2CAPB | DRT | EPHT3 | ERK | Hek5 | MGC87492 | PCBC | Tyro5EPH receptor B2-HPRD8878483 
The membrane bound ligand ELK-L interacts with the receptor NUK. This interaction was modeled on a demonstrated interaction between ELK-L from human and NUK from mouse.BIND8755474 
GRIP2-glutamate receptor interacting protein 2in vitro
in vivo
Two-hybrid
BioGRID9883737 |10197531 
NCK2GRB4 | NCKbetaNCK adaptor protein 2-HPRD11557983 
PICK1MGC15204 | PICK | PRKCABPprotein interacting with PRKCA 1-HPRD,BioGRID9883737 
PTPN13DKFZp686J1497 | FAP-1 | PNP1 | PTP-BAS | PTP-BL | PTP1E | PTPL1 | PTPLEprotein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)-HPRD,BioGRID9920925 
RGS3C2PA | FLJ20370 | FLJ31516 | FLJ90496 | PDZ-RGS3 | RGP3regulator of G-protein signaling 3-HPRD,BioGRID11301003 
SDCBPMDA-9 | ST1 | SYCL | TACIP18syndecan binding protein (syntenin)-HPRD,BioGRID9920925 
SORBS1CAP | DKFZp451C066 | DKFZp586P1422 | FLAF2 | FLJ12406 | KIAA1296 | R85FL | SH3D5 | SH3P12 | SORB1sorbin and SH3 domain containing 1-HPRD11557983 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)-HPRD,BioGRID8878483 
 
KEGG Pathway Info
hsa04360: Axon guidance - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1078348401Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-124/506200206m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-129-5p7307361Ahsa-miR-129brainCUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5pCUUUUUGCGGUCUGGGCUUGCU
miR-140149615021Ahsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-15/16/195/424/497117811841Ahsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-150130313091Ahsa-miR-150UCUCCCAACCCUUGUACCAGUG
miR-17-5p/20/93.mr/106/519.d11481154m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-185936942m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-2087998051Ahsa-miR-208AUAAGACGAGCAAAAAGCUUGU
miR-34/449118911951Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-381142514311Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-49163691Ahsa-miR-491brainAGUGGGGAACCCUUCCAUGAGGA
miR-496141214181Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-4997998051Ahsa-miR-499UUAAGACUUGCAGUGAUGUUUAA
miR-503117811841Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.