Gene Page: EGR2

Summary
GeneID  1959
Symbol  EGR2
Synonyms  AT591|CMT1D|CMT4E|DKFZp686J1957|FLJ14547|KROX20
Description  early growth response 2 (Krox-20 homolog, Drosophila)
See related  HGNC:3239|MIM:129010|Ensembl:ENSG00000122877|HPRD:00551|
Locus tag  -
Gene type  protein-coding
Map location  10q21.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIDA14532282 
GO:0005515protein bindingIPI14532282 
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007420brain developmentTASBrain (GO term level: 7)9537424 
GO:0007422peripheral nervous system developmentTAS9537424 
GO:0007638mechanosensory behaviorIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACP5MGC117378 | TRAPacid phosphatase 5, tartrate resistantTwo-hybridBioGRID16169070 
FASLGAPT1LG1 | CD178 | CD95L | FASL | TNFSF6Fas ligand (TNF superfamily, member 6)EGR2 interacts with p-FasL (FasL promoter).BIND11909874 
HCFC1CFF | HCF-1 | HCF1 | HFC1 | MGC70925 | VCAFhost cell factor C1 (VP16-accessory protein)-HPRD,BioGRID14532282 
MED313110004H13Rik | CGI-125 | FLJ27436 | FLJ36714 | Soh1mediator complex subunit 31Two-hybridBioGRID16169070 
NFATC1MGC138448 | NF-ATC | NFAT2 | NFATcnuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1Reconstituted ComplexBioGRID12560487 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1907913m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506858864m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-1375795861A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-141/200a102910351Ahsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-142-3p7379m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-1504014081A,m8hsa-miR-150UCUCCCAACCCUUGUACCAGUG
miR-17-5p/20/93.mr/106/519.d4584651A,m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-224101910261A,m8hsa-miR-224CAAGUCACUAGUGGUUCCGUUUA
miR-25/32/92/363/367612618m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-324-5p8268321Ahsa-miR-324-5pCGCAUCCCCUAGGGCAUUGGUGU
miR-34b9629681Ahsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
miR-377864870m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.