Gene Page: CRTC2

Summary
GeneID  200186
Symbol  CRTC2
Synonyms  RP11-422P24.6|TORC2
Description  CREB regulated transcription coactivator 2
See related  HGNC:27301|MIM:608972|Ensembl:ENSG00000160741|HPRD:12347|
Locus tag  -
Gene type  protein-coding
Map location  1q21.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0147 
 
Gene Expression ?
 
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0044419interspecies interaction between organismsIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PPP3CACALN | CALNA | CALNA1 | CCN1 | CNA1 | PPP2Bprotein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoformTORC2 interacts with CnA.BIND15454081 
SNF1LK2DKFZp434K1115 | KIAA0781 | LOH11CR1I | QIK | SIK2SNF1-like kinase 2TORC2 interacts with SIK2.BIND15454081 
-HPRD,BioGRID15454081 
YWHABGW128 | HS1 | KCIP-1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptideTORC2 interacts with 14-3-3-beta.BIND15454081 
YWHAG14-3-3GAMMAtyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptideAffinity Capture-MSBioGRID17353931 
-HPRD15324660 
YWHAQ14-3-3 | 1C5 | HS1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptideAffinity Capture-MS
Affinity Capture-Western
BioGRID15454081 |17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1493693761A,m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-369-3p4044101Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-374404410m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-93.hd/291-3p/294/295/302/372/373/520218224m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.