Gene Page: FBN2

Summary
GeneID  2201
Symbol  FBN2
Synonyms  CCA|DA9
Description  fibrillin 2
See related  HGNC:3604|MIM:121050|Ensembl:ENSG00000138829|HPRD:00416|
Locus tag  -
Gene type  protein-coding
Map location  5q23-q31
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005201extracellular matrix structural constituentTAS8120105 
GO:0005488bindingIEA-
GO:0005509calcium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0009653anatomical structure morphogenesisTAS7493032 
GO:0030326embryonic limb morphogenesisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005578proteinaceous extracellular matrixTAS8120105 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ELNFLJ38671 | FLJ43523 | SVAS | WBS | WSelastin-HPRD,BioGRID10825173 
FBN1FBN | MASS | MFS1 | OCTD | SGS | WMSfibrillin 1-HPRD,BioGRID10359653 |10504303 
MATN2-matrilin 2-HPRD,BioGRID12180907 
MFAP5MAGP2 | MP25microfibrillar associated protein 5-HPRD,BioGRID12122015 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1012102161Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-1364144201Ahsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-139746752m8hsa-miR-139brainUCUACAGUGCACGUGUCU
miR-1448028081Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-204/2114434501A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-2174024091A,m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-21813061312m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-22897903m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-221/2227487541Ahsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-23302308m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-3233013081A,m8hsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-3427717771Ahsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-3754244301Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-376c4314371Ahsa-miR-376cAACAUAGAGGAAAUUCCACG
miR-4102212271Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-485-3p114311501A,m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
miR-49514811487m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-4964334391Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-543134140m8hsa-miR-543AAACAUUCGCGGUGCACUUCU
miR-91791851Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.