Gene Page: KIF1B

Summary
GeneID  23095
Symbol  KIF1B
Synonyms  CMT2|CMT2A|CMT2A1|FLJ23699|HMSNII|KIAA0591|KIAA1448|KLP|MGC134844
Description  kinesin family member 1B
See related  HGNC:16636|MIM:605995|Ensembl:ENSG00000054523|HPRD:05818|
Locus tag  -
Gene type  protein-coding
Map location  1p36.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0018 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003777microtubule motor activityISS-
GO:0005515protein bindingIPI16225668 
GO:0005515protein bindingISS-
GO:0005524ATP bindingIEA-
GO:0016887ATPase activityISS-
GO:0019894kinesin bindingTAS10341097 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007018microtubule-based movementISS-
GO:0007270nerve-nerve synaptic transmissionISSneuron, Synap (GO term level: 7)-
GO:0007274neuromuscular synaptic transmissionISSneuron, Synap (GO term level: 7)-
GO:0008089anterograde axon cargo transportISSaxon (GO term level: 9)-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005739mitochondrionIEA-
GO:0005856cytoskeletonIEA-
GO:0005874microtubuleIEA-
GO:0005875microtubule associated complexISS-
GO:0030659cytoplasmic vesicle membraneISS-
GO:0031410cytoplasmic vesicleIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onsetProtein-peptideBioGRID14578343 
CPEB1CEBP | CPE-BP1 | CPEB | FLJ13203 | MGC34136 | MGC60106cytoplasmic polyadenylation element binding protein 1-HPRD12629046 
DLG1DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlgdiscs, large homolog 1 (Drosophila)-HPRD12097473 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)-HPRD12097473 
EEF1A1CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1eukaryotic translation elongation factor 1 alpha 1Two-hybridBioGRID16169070 
GIPC1C19orf3 | GIPC | GLUT1CBP | Hs.6454 | IIP-1 | MGC15889 | MGC3774 | NIP | RGS19IP1 | SEMCAP | SYNECTIIN | SYNECTIN | TIP-2GIPC PDZ domain containing family, member 1-HPRD,BioGRID10198040 
STARD13DLC2 | FLJ37385 | GT650StAR-related lipid transfer (START) domain containing 13-HPRD,BioGRID14697242 
STARD13 (RhoGAP) interacts with KIF1B.BIND14697242 
YWHAG14-3-3GAMMAtyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide-HPRD15324660 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/3516016071Ahsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-14527192725m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-15/16/195/424/49741454151m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-18547414747m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-188359536011Ahsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-19364636521Ahsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-205348034871A,m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-33026862692m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-339359335991Ahsa-miR-339UCCCUGUCCUCCAGGAGCUCA
miR-38148714877m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-409-5p49474953m8hsa-miR-409-5pAGGUUACCCGAGCAACUUUGCA
miR-45247314737m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-493-5p47784784m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.