Gene Page: PLCL2

Summary
GeneID  23228
Symbol  PLCL2
Synonyms  FLJ13484|KIAA1092|PLCE2
Description  phospholipase C-like 2
See related  HGNC:9064|Ensembl:ENSG00000154822|HPRD:07147|
Locus tag  -
Gene type  protein-coding
Map location  3p24.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004435phosphoinositide phospholipase C activityIEA-
GO:0004871signal transducer activityIEA-
GO:0005509calcium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006629lipid metabolic processIEA-
GO:0007242intracellular signaling cascadeIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DSCAML1KIAA1132Down syndrome cell adhesion molecule like 1-HPRD12421765 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1451131201A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-1811471541A,m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-271431501A,m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-3771691751Ahsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-3812292351Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.