Gene Page: MYST4

Summary
GeneID  23522
Symbol  MYST4
Synonyms  DKFZp313G1618|FLJ90335|KAT6B|KIAA0383|MORF|MOZ2|qkf|querkopf
Description  MYST histone acetyltransferase (monocytic leukemia) 4
See related  HGNC:17582|MIM:605880|Ensembl:ENSG00000156650|HPRD:07065|
Locus tag  -
Gene type  protein-coding
Map location  10q22.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
ExpressionExpressionP value: 1.614 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0004406H3/H4 histone acetyltransferase activityIEA-
GO:0008134transcription factor bindingIDA11965546 
GO:0008270zinc ion bindingIEA-
GO:0016407acetyltransferase activityIDA11965546 
GO:0016563transcription activator activityIDA10497217 
GO:0016564transcription repressor activityIDA10497217 
GO:0016740transferase activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006334nucleosome assemblyNAS10497217 
GO:0006355regulation of transcription, DNA-dependentNAS10497217 
GO:0016481negative regulation of transcriptionIDA10497217 
GO:0016568chromatin modificationIEA-
GO:0016573histone acetylationIDA11965546 
GO:0045941positive regulation of transcriptionIDA11965546 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000786nucleosomeNAS10497217 
GO:0005634nucleusTAS10497217 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
RUNX1AML1 | AML1-EVI-1 | AMLCR1 | CBFA2 | EVI-1 | PEBP2aBrunt-related transcription factor 1-HPRD,BioGRID11965546 
RUNX2AML3 | CBFA1 | CCD | CCD1 | MGC120022 | MGC120023 | OSF2 | PEA2aA | PEBP2A1 | PEBP2A2 | PEBP2aA | PEBP2aA1runt-related transcription factor 2-HPRD,BioGRID11965546 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2068999051Ahsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-24123512411Ahsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-38111401146m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.