Gene Page: CD2AP

Summary
GeneID  23607
Symbol  CD2AP
Synonyms  CMS|DKFZp586H0519
Description  CD2-associated protein
See related  HGNC:14258|MIM:604241|Ensembl:ENSG00000198087|HPRD:05026|
Locus tag  -
Gene type  protein-coding
Map location  6p12
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005200structural constituent of cytoskeletonTAS10339567 
GO:0005515protein bindingIPI12029088 |14679214 
GO:0017124SH3 domain bindingIDA10339567 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006461protein complex assemblyTAS10339567 
GO:0006930substrate-bound cell migration, cell extensionTAS10339567 
GO:0007049cell cycleIEA-
GO:0007067mitosisIEA-
GO:0007165signal transductionNAS10339567 
GO:0051301cell divisionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0001726ruffleIDA10339567 
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmTAS10339567 
GO:0005886plasma membraneIDA18029348 
GO:0015629actin cytoskeletonTAS10339567 
GO:0031941filamentous actinIDA10339567 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BCAR1CAS | CAS1 | CASS1 | CRKAS | P130Casbreast cancer anti-estrogen resistance 1-HPRD,BioGRID10339567 
CAPZA1CAPPA1 | CAPZ | CAZ1capping protein (actin filament) muscle Z-line, alpha 1-HPRD,BioGRID12690097 
CASKCAGH39 | CMG | FLJ22219 | FLJ31914 | LIN2 | MICPCH | TNRC8calcium/calmodulin-dependent serine protein kinase (MAGUK family)Reconstituted ComplexBioGRID15331416 
CBLC-CBL | CBL2 | RNF55Cas-Br-M (murine) ecotropic retroviral transforming sequenceCMS interacts with Cbl. This interaction was modeled on a demonstrated interaction between CMS from an unspecified species and human Cbl.BIND15128873 
-HPRD,BioGRID11067845 
CD2SRBC | T11CD2 moleculeReconstituted ComplexBioGRID12690097 
-HPRD9741631 
CD2APCMS | DKFZp586H0519CD2-associated protein-HPRD,BioGRID10339567 
CDH3CDHP | HJMD | PCADcadherin 3, type 1, P-cadherin (placental)Affinity Capture-WesternBioGRID15331416 
FYNMGC45350 | SLK | SYNFYN oncogene related to SRC, FGR, YES-HPRD10339567 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2-HPRD10339567 
NPHS1CNF | NPHNnephrosis 1, congenital, Finnish type (nephrin)-HPRD,BioGRID10997929 
NPHS2PDCN | SRN1nephrosis 2, idiopathic, steroid-resistant (podocin)-HPRD,BioGRID11733557 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)-HPRD10339567 
PKD2APKD2 | MGC138466 | MGC138468 | PC2 | PKD4polycystic kidney disease 2 (autosomal dominant)-HPRD10913159 
PTK2BCADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTKPTK2B protein tyrosine kinase 2 betaAffinity Capture-WesternBioGRID15128873 
RAB4AHRES-1/RAB4 | RAB4RAB4A, member RAS oncogene family-HPRD,BioGRID12559036 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)-HPRD10339567 
YES1HsT441 | P61-YES | Yes | c-yesv-yes-1 Yamaguchi sarcoma viral oncogene homolog 1-HPRD10339567 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/206278427911A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-128248624921Ahsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-137264226481Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-15/16/195/424/497269827051A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-181229022971A,m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-182227522821A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-219258425911A,m8hsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-221/222263926451Ahsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-25/32/92/363/36726592665m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-26256025661Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-2724862492m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-369-3p308314m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-409-3p27832789m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-4101561621Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-4522222291A,m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-485-3p25682574m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
miR-503269927051Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
miR-96227622821Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.