Gene Page: GNAI2

Summary
GeneID  2771
Symbol  GNAI2
Synonyms  GIP|GNAI2B|H_LUCA15.1|H_LUCA16.1
Description  guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
See related  HGNC:4385|MIM:139360|Ensembl:ENSG00000114353|HPRD:00764|
Locus tag  -
Gene type  protein-coding
Map location  3p21
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 2.0369 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityTAS9637720 
GO:0004871signal transducer activityIEA-
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI16189514 
GO:0005525GTP bindingIEA-
GO:0019001guanyl nucleotide bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionIEA-
GO:0007165signal transductionTAS7961880 |9637720 
GO:0007193G-protein signaling, adenylate cyclase inhibiting pathwayIEA-
GO:0007194negative regulation of adenylate cyclase activityTAS9637720 
GO:0007213acetylcholine receptor signaling, muscarinic pathwayIEA-
GO:0007584response to nutrientTAS8587610 
GO:0008283cell proliferationIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ADORA1RDC7adenosine A1 receptor-HPRD,BioGRID11369591 
ADRA2BADRA2L1 | ADRA2RL1 | ADRARL1 | ALPHA2BARadrenergic, alpha-2B-, receptor-HPRD2169434 
C5AR1C5A | C5AR | C5R1 | CD88complement component 5a receptor 1-HPRD,BioGRID7962171 
CHRM1HM1 | M1 | MGC30125cholinergic receptor, muscarinic 1-HPRD,BioGRID8190105 
CNR1CANN6 | CB-R | CB1 | CB1A | CB1K5 | CB1R | CNRcannabinoid receptor 1 (brain)-HPRD,BioGRID11168387 
DRD2D2DR | D2Rdopamine receptor D2-HPRD10978845 
EDNRAETA | ETRAendothelin receptor type A-HPRD,BioGRID7882989 
EGFRERBB | ERBB1 | HER1 | PIG61 | mENAepidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)-HPRD11286993 
EYA2EAB1 | MGC10614eyes absent homolog 2 (Drosophila)-HPRD,BioGRID10906137 
F2RCF2R | HTR | PAR1 | TRcoagulation factor II (thrombin) receptorin vitroBioGRID10644723 
FPR1FMLP | FPRformyl peptide receptor 1-HPRD8663057 
GPSM2LGN | PinsG-protein signaling modulator 2 (AGS3-like, C. elegans)-HPRD,BioGRID8973305 
IGF1RCD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216insulin-like growth factor 1 receptor-HPRD11120746 
IL8CXCL8 | GCP-1 | GCP1 | LECT | LUCT | LYNAP | MDNCF | MONAP | NAF | NAP-1 | NAP1interleukin 8-HPRD,BioGRID8662698 
IL8RAC-C | C-C-CKR-1 | CD128 | CD181 | CDw128a | CKR-1 | CMKAR1 | CXCR1 | IL8R1 | IL8RBAinterleukin 8 receptor, alpha-HPRD,BioGRID8662698 |8903513 
LHCGRFLJ41504 | LCGR | LGR2 | LH/CG-R | LH/CGR | LHR | LHRHR | LSH-Rluteinizing hormone/choriogonadotropin receptor-HPRD10493819 
LPAR3EDG7 | Edg-7 | FLJ98231 | GPCR | HOFNH30 | LP-A3 | LPA3 | RP4-678I3lysophosphatidic acid receptor 3-HPRD10727522 
MDFII-MF | I-mfaMyoD family inhibitorAffinity Capture-Western
Two-hybrid
BioGRID16189514 
MTNR1AMEL-1A-R | MT1melatonin receptor 1A-HPRD,BioGRID10598579 
NUCB1DKFZp686A15286 | FLJ40471 | NUCnucleobindin 1-HPRD,BioGRID9647645 
OPRD1OPRDopioid receptor, delta 1-HPRD,BioGRID1671672 
OPRM1KIAA0403 | MOR | MOR1 | OPRMopioid receptor, mu 1-HPRD,BioGRID12068084 
P2RY12ADPG-R | HORK3 | P2T(AC) | P2Y(AC) | P2Y(ADP) | P2Y(cyc) | P2Y12 | SP1999purinergic receptor P2Y, G-protein coupled, 12-HPRD,BioGRID8554519 
PLSCR1MMTRA1Bphospholipid scramblase 1Two-hybridBioGRID16189514 
RASD1AGS1 | DEXRAS1 | MGC:26290RAS, dexamethasone-induced 1-HPRD,BioGRID10471929 |10840027 
RGS12DKFZp761K1617 | DKFZp761K1817regulator of G-protein signaling 12-HPRD,BioGRID11387333 
RGS14-regulator of G-protein signaling 14-HPRD,BioGRID11387333 
RGS16A28-RGS14 | A28-RGS14P | RGS-Rregulator of G-protein signaling 16Reconstituted ComplexBioGRID9079700 
RGS18RGS13regulator of G-protein signaling 18-HPRD,BioGRID11955952 
RGS19GAIP | RGSGAIPregulator of G-protein signaling 19-HPRD,BioGRID8986788 
RGS4DKFZp761F1924 | MGC2124 | MGC60244 | RGP4 | SCZD9regulator of G-protein signaling 4-HPRD,BioGRID9660808 
RGS5MST092 | MST106 | MST129 | MSTP032 | MSTP092 | MSTP106 | MSTP129regulator of G-protein signaling 5-HPRD,BioGRID9079700 
RIC8AMGC104517 | MGC131931 | MGC148073 | MGC148074 | RIC8 | synembrynresistance to inhibitors of cholinesterase 8 homolog A (C. elegans)-HPRD,BioGRID12509430 
TTC1FLJ46404 | TPR1tetratricopeptide repeat domain 1-HPRD,BioGRID12748287 
 
KEGG Pathway Info
hsa04360: Axon guidance - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04530: Tight junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04540: Gap junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04670: Leukocyte transendothelial migration - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04730: Long-term depression - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04916: Melanogenesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506662668m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-138375381m8hsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-214874880m8hsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-2184674741A,m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-221/222837843m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-30-5p4054121A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-3394104161Ahsa-miR-339UCCCUGUCCUCCAGGAGCUCA
miR-34/4497757811Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-378*3964031A,m8hsa-miR-422bCUGGACUUGGAGUCAGAAGGCC
hsa-miR-422aCUGGACUUAGGGUCAGAAGGCC
miR-384858864m8hsa-miR-384AUUCCUAGAAAUUGUUCAUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.