Gene Page: GNAZ

Summary
GeneID  2781
Symbol  GNAZ
Synonyms  -
Description  guanine nucleotide binding protein (G protein), alpha z polypeptide
See related  HGNC:4395|MIM:139160|Ensembl:ENSG00000128266|HPRD:00746|
Locus tag  -
Gene type  protein-coding
Map location  22q11.22
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.031 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.2005 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityTAS2117645 
GO:0005057receptor signaling protein activityTAS2456569 
GO:0005525GTP bindingIEA-
GO:0019001guanyl nucleotide bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionIEA-
GO:0007186G-protein coupled receptor protein signaling pathwayTAS3129724 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005635nuclear envelopeTAS2117645 
GO:0005737cytoplasmIDA18029348 
GO:0005783endoplasmic reticulumTAS2117645 
GO:0005886plasma membraneTAS3129724 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DRD2D2DR | D2Rdopamine receptor D2-HPRD9166747 
DRD5DBDR | DRD1B | DRD1L2 | MGC10601dopamine receptor D5-HPRD9603210 
EYA2EAB1 | MGC10614eyes absent homolog 2 (Drosophila)-HPRD,BioGRID10906137 
OPRD1OPRDopioid receptor, delta 1-HPRD9166747 
RAP1GAPKIAA0474 | RAP1GA1 | Rap1GAP1 | rap1GAPIIRAP1 GTPase activating protein-HPRD,BioGRID10593970 
RGS10-regulator of G-protein signaling 10Affinity Capture-WesternBioGRID8774883 
RGS19GAIP | RGSGAIPregulator of G-protein signaling 19-HPRD,BioGRID8986788 
RGS20RGSZ1 | ZGAP1regulator of G-protein signaling 20-HPRD9748279|12414994 
Biochemical Activity
Co-localization
BioGRID9748279 |12414994 
RGS7-regulator of G-protein signaling 7-HPRD,BioGRID10092682 
 
KEGG Pathway Info
hsa04730: Long-term depression - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-129-5p637643m8hsa-miR-129brainCUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5pCUUUUUGCGGUCUGGGCUUGCU
miR-186858864m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-27126012661Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-3318086m8hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-4506376431Ahsa-miR-450UUUUUGCGAUGUGUUCCUAAUA
miR-4521531601A,m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-542-3p2732801A,m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.