Gene Page: GOT2

Summary
GeneID  2806
Symbol  GOT2
Synonyms  FLJ40994|KAT4|KATIV|mitAAT
Description  glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)
See related  HGNC:4433|MIM:138150|Ensembl:ENSG00000125166|HPRD:00684|
Locus tag  -
Gene type  protein-coding
Map location  16q21
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004069aspartate transaminase activityEXPglutamate (GO term level: 6)4052435 
GO:0004069aspartate transaminase activityIDAglutamate (GO term level: 6)2182221 |2567216 |2731362 
GO:0030170pyridoxal phosphate bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006520amino acid metabolic processIEA-
GO:0006533aspartate catabolic processIDA2567216 
GO:0009058biosynthetic processIEA-
GO:0015908fatty acid transportIEP9537447 
GO:0045471response to ethanolIDA9537447 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005739mitochondrionIDA9537447 
GO:0005743mitochondrial inner membraneIEA-
GO:0005759mitochondrial matrixEXP4052435 
GO:0005759mitochondrial matrixIEA-
GO:0005886plasma membraneIDA9537447 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CTNNBIP1ICAT | MGC15093catenin, beta interacting protein 1Affinity Capture-MSBioGRID17353931 
GLUD1GDH | GDH1 | GLUD | MGC132003glutamate dehydrogenase 1-HPRD3997814 
HSPA8HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71heat shock 70kDa protein 8-HPRD,BioGRID7559589 
MDH2M-MDH | MDH | MGC:3559 | MOR1malate dehydrogenase 2, NAD (mitochondrial)-HPRD2899080 
MPGAAG | APNG | CRA36.1 | MDG | Mid1 | PIG11 | PIG16 | anpgN-methylpurine-DNA glycosylaseAffinity Capture-MSBioGRID17353931 
THOC7FLJ23445 | NIF3L1BP1 | fSAP24THO complex 7 homolog (Drosophila)Two-hybridBioGRID16169070 
 
KEGG Pathway Info
hsa00251: Glutamate metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00252: Alanine and aspartate metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00272: Cysteine metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00330: Arginine and proline metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00350: Tyrosine metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00360: Phenylalanine metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00400: Phenylalanine, tyrosine and tryptophan biosynthesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00950: Alkaloid biosynthesis I - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-5p2552611Ahsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.