Gene Page: SLCO3A1

Summary
GeneID  28232
Symbol  SLCO3A1
Synonyms  FLJ40478|OATP-D|OATP3A1|SLC21A11
Description  solute carrier organic anion transporter family, member 3A1
See related  HGNC:10952|MIM:612435|Ensembl:ENSG00000176463|HPRD:07502|
Locus tag  -
Gene type  protein-coding
Map location  15q26
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005215transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/3513153211Ahsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-1491661731A,m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-1823073131Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-34/4493043111A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-963073131Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.