Gene Page: GPX3

Summary
GeneID  2878
Symbol  GPX3
Synonyms  GPx-P|GSHPx-3|GSHPx-P
Description  glutathione peroxidase 3 (plasma)
See related  HGNC:4555|MIM:138321|Ensembl:ENSG00000211445|HPRD:11750|
Locus tag  -
Gene type  protein-coding
Map location  5q23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0032 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01718 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00459 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004602glutathione peroxidase activityIDA1897960 |3693360 
GO:0008134transcription factor bindingTAS8056346 
GO:0008430selenium bindingIDA2491950 |3693360 
GO:0016491oxidoreductase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006979response to oxidative stressIEA-
GO:0006982response to lipid hydroperoxideTAS2491950 
GO:0042744hydrogen peroxide catabolic processTAS2491950 
GO:0051289protein homotetramerizationIDA3693360 
GO:0055114oxidation reductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005615extracellular spaceIDA1897960 
 
KEGG Pathway Info
hsa00480: Glutathione metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa00590: Arachidonic acid metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-24703709m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-37849551Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.