Gene Page: BZW2

Summary
GeneID  28969
Symbol  BZW2
Synonyms  HSPC028|MST017|MSTP017
Description  basic leucine zipper and W2 domains 2
See related  HGNC:18808|Ensembl:ENSG00000136261|HPRD:16571|
Locus tag  -
Gene type  protein-coding
Map location  7p21.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007275multicellular organismal developmentIEA-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0030154cell differentiationIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BZW1BZAP45 | KIAA0005 | Nbla10236basic leucine zipper and W2 domains 1Affinity Capture-MSBioGRID17353931 
PSTPIP1CD2BP1 | CD2BP1L | CD2BP1S | H-PIP | PAPAS | PSTPIPproline-serine-threonine phosphatase interacting protein 1Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98207213m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-101314320m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-135236242m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.