Gene Page: GRIN2A

Summary
GeneID  2903
Symbol  GRIN2A
Synonyms  NMDAR2A|NR2A
Description  glutamate receptor, ionotropic, N-methyl D-aspartate 2A
See related  HGNC:4585|MIM:138253|Ensembl:ENSG00000183454|HPRD:00698|
Locus tag  -
Gene type  protein-coding
Map location  16p13.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenics, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 15 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000287magnesium ion bindingIEA-
GO:0004872receptor activityIEA-
GO:0004970ionotropic glutamate receptor activityIEAglutamate (GO term level: 7)-
GO:0004972N-methyl-D-aspartate selective glutamate receptor activityTASglutamate (GO term level: 8)8768735 
GO:0005216ion channel activityIEA-
GO:0005234extracellular-glutamate-gated ion channel activityIEAglutamate (GO term level: 11)-
GO:0005262calcium channel activityIEA-
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIPI17997397 
GO:0035254glutamate receptor bindingIEAglutamate (GO term level: 5)-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001964startle responseIEA-
GO:0001975response to amphetamineIEA-
GO:0006811ion transportIEA-
GO:0006816calcium ion transportIEA-
GO:0007215glutamate signaling pathwayTASglutamate (GO term level: 7)8768735 
GO:0007613memoryIEA-
GO:0008104protein localizationIEA-
GO:0008542visual learningIEA-
GO:0009611response to woundingIEA-
GO:0022008neurogenesisIEAneurogenesis (GO term level: 6)-
GO:0030431sleepIEABrain (GO term level: 3)-
GO:0033058directional locomotionIEA-
GO:0042177negative regulation of protein catabolic processIEA-
GO:0042417dopamine metabolic processIEANeurotransmitter, dopamine (GO term level: 8)-
GO:0042428serotonin metabolic processIEAserotonin, Neurotransmitter (GO term level: 8)-
GO:0042493response to drugIEA-
GO:0045471response to ethanolIDA18445116 
GO:0048167regulation of synaptic plasticityIEASynap (GO term level: 8)-
GO:0051930regulation of sensory perception of painIEA-
GO:0060079regulation of excitatory postsynaptic membrane potentialIEAneuron, Synap (GO term level: 10)-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIDA18029348 
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS8768735 
GO:0014069postsynaptic densityIEASynap (GO term level: 10)-
GO:0016021integral to membraneIEA-
GO:0017146N-methyl-D-aspartate selective glutamate receptor complexIDAglutamate, Synap (GO term level: 10)10480938 
GO:0019717synaptosomeIEASynap, Brain (GO term level: 7)-
GO:0030054cell junctionIEA-
GO:0042734presynaptic membraneIEAneuron, axon, Synap (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTN1FLJ40884actinin, alpha 1-HPRD11854440 
DLG1DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlgdiscs, large homolog 1 (Drosophila)-HPRD,BioGRID12933808 
DLG2DKFZp781D1854 | DKFZp781E0954 | FLJ37266 | MGC131811 | PSD-93discs, large homolog 2, chapsyn-110 (Drosophila)-HPRD10648730 
Two-hybridBioGRID9278515 
DLG3KIAA1232 | MRX | MRX90 | NE-Dlg | NEDLG | SAP102discs, large homolog 3 (neuroendocrine-dlg, Drosophila)in vitro
in vivo
Two-hybrid		BioGRID9278515 |11937501 
-HPRD11937501 |12070168 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)-HPRD7569905 |11937501 
|12419528 
Affinity Capture-Western
in vitro
in vivo
Reconstituted Complex
Two-hybrid		BioGRID7569905 |9278515 
|9286858 |10648730 
|11937501 |12419528 
DLGAP1DAP-1 | DAP-1-ALPHA | DAP-1-BETA | GKAP | MGC88156 | SAPAP1 | hGKAPdiscs, large (Drosophila) homolog-associated protein 1-HPRD,BioGRID9286858 
FYNMGC45350 | SLK | SYNFYN oncogene related to SRC, FGR, YESAffinity Capture-Western
Reconstituted Complex		BioGRID9892651 |10458595 
|12419528 |12932824 
-HPRD10458595 |12932824 
GRIN1NMDA1 | NMDAR1 | NR1glutamate receptor, ionotropic, N-methyl D-aspartate 1NR1a interacts with NR2A.BIND11279200 
-HPRD8139656 |10862698 
|11803122 |12068077 
|12191494 |12893641 
|14732708 
Affinity Capture-WesternBioGRID12391275 
GRIN3BNR3Bglutamate receptor, ionotropic, N-methyl-D-aspartate 3BAffinity Capture-WesternBioGRID12008020 
IL16FLJ16806 | FLJ42735 | FLJ44234 | HsT19289 | IL-16 | LCF | prIL-16interleukin 16 (lymphocyte chemoattractant factor)npro-IL-16 interacts with NR2A.BIND12923170 
-HPRD,BioGRID10479680 
INADLCipp | FLJ26982 | InaD-like | PATJInaD-like (Drosophila)-HPRD9647694 
PTK2BCADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTKPTK2B protein tyrosine kinase 2 beta-HPRD,BioGRID11478920 
PTPN4PTPMEG | PTPMEG1protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)-HPRD,BioGRID10748123 
RICSGC-GAP | GRIT | KIAA0712 | MGC1892 | p200RhoGAP | p250GAPRho GTPase-activating protein-HPRD12531901 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)Affinity Capture-Western
Reconstituted Complex		BioGRID10458595 |12932824 
-HPRD10458595 |10884433 
|12932824 
 
KEGG Pathway Info
hsa04020: Calcium signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04080: Neuroactive ligand-receptor interaction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04720: Long-term potentiation - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05010: Alzheimer's disease - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05014: Amyotrophic lateral sclerosis (ALS) - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05322: Systemic lupus erythematosus - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/351904910m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-1374164231A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-191421491A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-3819119171Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-4316566621Ahsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-71661721Ahsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.