Gene Page: GTF2H1

Summary
GeneID  2965
Symbol  GTF2H1
Synonyms  BTF2|TFB1|TFIIH
Description  general transcription factor IIH, polypeptide 1, 62kDa
See related  HGNC:4655|MIM:189972|Ensembl:ENSG00000110768|HPRD:01807|
Locus tag  -
Gene type  protein-coding
Map location  11p15.1-p14
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0312 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI8652557 
GO:0008353RNA polymerase subunit kinase activityTAS7533895 
GO:0016251general RNA polymerase II transcription factor activityTAS9118947 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000079regulation of cyclin-dependent protein kinase activityTAS7533895 
GO:0000718nucleotide-excision repair, DNA damage removalEXP10583946 
GO:0006281DNA repairTAS9118947 
GO:0006350transcriptionIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006367transcription initiation from RNA polymerase II promoterEXP8946909 
GO:0006368RNA elongation from RNA polymerase II promoterEXP9405375 
GO:0045944positive regulation of transcription from RNA polymerase II promoterIDA8692841 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005654nucleoplasmEXP1939271 |2449431 |8946909 
|9512541 |9582279 
|9790902 |10214908 
|11313499 |12393749 
|12646563 
GO:0005675holo TFIIH complexTAS9118947 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptor-HPRD,BioGRID10734072 |11266437 
ATF7IPFLJ10139 | FLJ10688 | MCAF | p621activating transcription factor 7 interacting protein-HPRD10777215 
CCNHCAK | p34 | p37cyclin H-HPRD,BioGRID7533895 
CDK7CAK1 | CDKN7 | MO15 | STK1 | p39MO15cyclin-dependent kinase 7-HPRD,BioGRID9130708 
E2F1E2F-1 | RBAP1 | RBBP3 | RBP3E2F transcription factor 1-HPRD,BioGRID10428966 
ERCC2COFS2 | EM9 | MGC102762 | MGC126218 | MGC126219 | TTD | XPDexcision repair cross-complementing rodent repair deficiency, complementation group 2Affinity Capture-Western
Reconstituted Complex
BioGRID8152490 |9130708 
ERCC3BTF2 | GTF2H | RAD25 | TFIIH | XPBexcision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)Affinity Capture-Western
Co-purification
BioGRID9118947 |9130708 
|15220921 
-HPRD8194528 |9118947 
ERCC5COFS3 | ERCM2 | UVDR | XPG | XPGCexcision repair cross-complementing rodent repair deficiency, complementation group 5-HPRD8652557 
ESR1DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1estrogen receptor 1-HPRD,BioGRID10949034 
FUBP1FBP | FUBPfar upstream element (FUSE) binding protein 1-HPRD,BioGRID11239393 
GTF2E1FE | TF2E1 | TFIIE-Ageneral transcription factor IIE, polypeptide 1, alpha 56kDa-HPRD11113176 
HNRNPUHNRPU | SAF-A | U21.1heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)-HPRD10490622 
KIAA1128FLJ14262 | FLJ25809 | Gcap14 | bA486O22.1KIAA1128Two-hybridBioGRID16169070 
KIF13AFLJ27232 | bA500C11.2kinesin family member 13A-HPRD10777215 
MMS19FLJ34167 | FLJ95146 | MET18 | MGC99604 | MMS19L | hMMS19MMS19 nucleotide excision repair homolog (S. cerevisiae)-HPRD11071939 
PLCG1PLC-II | PLC1 | PLC148 | PLCgamma1phospholipase C, gamma 1-HPRD10467411 
POLR2AMGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1polymerase (RNA) II (DNA directed) polypeptide A, 220kDa-HPRD9710619 
PSMC2MGC3004 | MSS1 | Nbla10058 | S7proteasome (prosome, macropain) 26S subunit, ATPase, 2-HPRD,BioGRID11118327 
TCEA1GTF2S | SII | TCEA | TF2S | TFIIStranscription elongation factor A (SII), 1Reconstituted ComplexBioGRID9305922 |9765293 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD,BioGRID7935417 
 
KEGG Pathway Info
hsa03022: Basal transcription factors - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa03420: Nucleotide excision repair - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-104514581A,m8hsa-miR-10aUACCCUGUAGAUCCGAAUUUGUG
hsa-miR-10bUACCCUGUAGAACCGAAUUUGU
miR-148/1526686751A,m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-191531591Ahsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-30-5p300306m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-3308348411A,m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-3637948001Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-3783163221Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.