Gene Page

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	10734072 \|11266437
ATF7IP	FLJ10139 \| FLJ10688 \| MCAF \| p621	activating transcription factor 7 interacting protein	-	HPRD	10777215
CCNH	CAK \| p34 \| p37	cyclin H	-	HPRD,BioGRID	7533895
CDK7	CAK1 \| CDKN7 \| MO15 \| STK1 \| p39MO15	cyclin-dependent kinase 7	-	HPRD,BioGRID	9130708
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	-	HPRD,BioGRID	10428966
ERCC2	COFS2 \| EM9 \| MGC102762 \| MGC126218 \| MGC126219 \| TTD \| XPD	excision repair cross-complementing rodent repair deficiency, complementation group 2	Affinity Capture-Western Reconstituted Complex	BioGRID	8152490 \|9130708
ERCC3	BTF2 \| GTF2H \| RAD25 \| TFIIH \| XPB	excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)	Affinity Capture-Western Co-purification	BioGRID	9118947 \|9130708 \|15220921
ERCC3	BTF2 \| GTF2H \| RAD25 \| TFIIH \| XPB		-	HPRD	8194528 \|9118947
ERCC5	COFS3 \| ERCM2 \| UVDR \| XPG \| XPGC	excision repair cross-complementing rodent repair deficiency, complementation group 5	-	HPRD	8652557
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	10949034
FUBP1	FBP \| FUBP	far upstream element (FUSE) binding protein 1	-	HPRD,BioGRID	11239393
GTF2E1	FE \| TF2E1 \| TFIIE-A	general transcription factor IIE, polypeptide 1, alpha 56kDa	-	HPRD	11113176
HNRNPU	HNRPU \| SAF-A \| U21.1	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	-	HPRD	10490622
KIAA1128	FLJ14262 \| FLJ25809 \| Gcap14 \| bA486O22.1	KIAA1128	Two-hybrid	BioGRID	16169070
KIF13A	FLJ27232 \| bA500C11.2	kinesin family member 13A	-	HPRD	10777215
MMS19	FLJ34167 \| FLJ95146 \| MET18 \| MGC99604 \| MMS19L \| hMMS19	MMS19 nucleotide excision repair homolog (S. cerevisiae)	-	HPRD	11071939
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD	10467411
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	-	HPRD	9710619
PSMC2	MGC3004 \| MSS1 \| Nbla10058 \| S7	proteasome (prosome, macropain) 26S subunit, ATPase, 2	-	HPRD,BioGRID	11118327
TCEA1	GTF2S \| SII \| TCEA \| TF2S \| TFIIS	transcription elongation factor A (SII), 1	Reconstituted Complex	BioGRID	9305922 \|9765293
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	7935417

KEGG Pathway Info

hsa03022: Basal transcription factors - Homo sapiens (human)	Go to KEGG	All SZGR genes in this pathway
hsa03420: Nucleotide excision repair - Homo sapiens (human)	Go to KEGG	All SZGR genes in this pathway

miRNA Targets ?

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	451	458	1A,m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	451	458	1A,m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-148/152	668	675	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-19	153	159	1A	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	153	159	1A	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-30-5p	300	306	m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-330	834	841	1A,m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-363	794	800	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-378	316	322	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.