Gene Page: PURG

Summary
GeneID  29942
Symbol  PURG
Synonyms  MGC119274|PURG-A|PURG-B
Description  purine-rich element binding protein G
See related  HGNC:17930|Ensembl:ENSG00000172733|HPRD:17933|
Locus tag  -
Gene type  protein-coding
Map location  8p11
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.03086 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.00057 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1836436491Ahsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-326201207m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-409-5p622628m8hsa-miR-409-5pAGGUUACCCGAGCAACUUUGCA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.