Gene Page: HIP1

Summary
GeneID  3092
Symbol  HIP1
Synonyms  ILWEQ|MGC126506
Description  huntingtin interacting protein 1
See related  HGNC:4913|MIM:601767|Ensembl:ENSG00000127946|HPRD:03461|
Locus tag  -
Gene type  protein-coding
Map location  7q11.23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003779actin bindingIEA-
GO:0005200structural constituent of cytoskeletonTAS9140394 
GO:0005543phospholipid bindingIEA-
GO:0030276clathrin bindingIDASynap (GO term level: 4)11577110 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006897endocytosisIDA11577110 |11604514 
GO:0006919caspase activationIDA11788820 
GO:0042981regulation of apoptosisIDA11788820 
GO:0048268clathrin coat assemblyIDA11577110 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005624membrane fractionTAS9147654 
GO:0005737cytoplasmIDA11604514 
GO:0005794Golgi apparatusIDA11788820 
GO:0005856cytoskeletonTAS9147654 
GO:0012505endomembrane systemIEA-
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AP2A1ADTAA | AP2-ALPHA | CLAPA1adaptor-related protein complex 2, alpha 1 subunit-HPRD11517213 |11532990|11532990 
-HPRD,BioGRID11532990 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidase-HPRD,BioGRID11788820 
CLTALCAclathrin, light chain (Lca)-HPRD11889126 
CLTBLCBclathrin, light chain (Lcb)-HPRD1189126 
CLTCCHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034clathrin, heavy chain (Hc)HIP1 interacts with Clathrin-HC (Clathrin heavy chain).BIND11517213 
-HPRD,BioGRID11532990 
EIF62 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBPeukaryotic translation initiation factor 6Two-hybridBioGRID16169070 
HIP1ILWEQ | MGC126506huntingtin interacting protein 1-HPRD11063258 
HIP1 interacts with itself.BIND11063258 
HIP1RFLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513huntingtin interacting protein 1 related-HPRD11063258 
-HPRD,BioGRID11063258 |11889126 
HIP1 interacts with HIP12.BIND11063258 
HTTHD | IT15huntingtin-HPRD,BioGRID9147654 |11063258 
HIP1 interacts with HD.BIND11063258 
IFT57ESRRBL1 | FLJ10147 | HIPPI | MHS4R2intraflagellar transport 57 homolog (Chlamydomonas)-HPRD,BioGRID11788820 
PFDN1PDF | PFD1prefoldin subunit 1Two-hybridBioGRID16169070 
RPS10MGC88819ribosomal protein S10Two-hybridBioGRID16169070 
 
KEGG Pathway Info
hsa05040: Huntington's disease - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506875881m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-128178717941A,m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-27178817951A,m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.