Gene Page: IGF2R

Summary
GeneID  3482
Symbol  IGF2R
Synonyms  CD222|CIMPR|M6P-R|MPR1|MPRI
Description  insulin-like growth factor 2 receptor
See related  HGNC:5467|MIM:147280|Ensembl:ENSG00000197081|HPRD:00928|
Locus tag  -
Gene type  protein-coding
Map location  6q26
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityTAS7753549 
GO:0005010insulin-like growth factor receptor activityTAS10799489 
GO:0005215transporter activityIEA-
GO:0005515protein bindingIEA-
GO:0005520insulin-like growth factor bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006810transportIEA-
GO:0006898receptor-mediated endocytosisTAS10799489 
GO:0007165signal transductionTAS7753549 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005641nuclear envelope lumenIEA-
GO:0005737cytoplasmIEA-
GO:0005765lysosomal membraneIEA-
GO:0005768endosomeIDA15078902 
GO:0005887integral to plasma membraneTAS10799489 
GO:0016020membraneIEA-
GO:0030140trans-Golgi network transport vesicleIDA15078902 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AGAAGU | ASRG | GAaspartylglucosaminidase-HPRD9362483 
CREG1CREGcellular repressor of E1A-stimulated genes 1-HPRD,BioGRID12934103 
CTSDCLN10 | CPSD | MGC2311cathepsin DCTSD (CD) interacts with IGF2R (MPR300).BIND15258139 
GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1-HPRD11387475 |11390366 
GGA2FLJ20966 | KIAA1080 | VEARgolgi associated, gamma adaptin ear containing, ARF binding protein 2-HPRD11387476 
-HPRD11387475 |11387476 
GGA3KIAA0154golgi associated, gamma adaptin ear containing, ARF binding protein 3-HPRD11387475 
GZMBCCPI | CGL-1 | CGL1 | CSP-B | CSPB | CTLA1 | CTSGL1 | HLP | SECTgranzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)-HPRD11081635 
M6PRBP1MGC11117 | MGC2012 | PP17 | TIP47mannose-6-phosphate receptor binding protein 1M6PRBP1 (TIP47) interacts with IGF2R (CI-MPR).BIND9590177 
-HPRD,BioGRID9590177 |10908666 
M6PRBP1 (TIP47) interacts with IGF2R (CI-MPR).BIND10908666 
M6PRBP1 (TIP47) interacts with IGF2R (CI-MPR).BIND11359012 
M6PRBP1 (TIP47) interacts with IGF2R (CI-MPR).BIND12032303 
M6PRBP1 (TIP47) interacts with IGF2R (CI-MPR).BIND10829017 
TIP47 interacts with CI-MPR. This interaction was modeled on a demostrated interaction between a modified synthetic peptide representing human TIP47 and CI-MPR from an unspecified species.BIND15782153 
PACS1FLJ10209 | KIAA1175phosphofurin acidic cluster sorting protein 1-HPRD9695949 |11331585 
PLAUATF | UPA | URK | UROKINASE | u-PAplasminogen activator, urokinase-HPRD9566979 
PLAURCD87 | UPAR | URKRplasminogen activator, urokinase receptorReconstituted ComplexBioGRID9566979 
USF1FCHL | FCHL1 | HYPLIP1 | MLTF | MLTFI | UEF | bHLHb11upstream transcription factor 1An unspecified isoform of USF1 interacts with IGF2R promoter.BIND12857727 
USF2FIP | bHLHb12upstream transcription factor 2, c-fos interactingAn unspecified isoform of USF2 interacts with IGF2R promoter.BIND12857727 
WISP2CCN5 | CT58 | CTGF-LWNT1 inducible signaling pathway protein 2-HPRD10358067 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.199810041Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-15/16/195/424/497318324m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-185372378m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-19100510121A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-204/2111141211A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-224101710241A,m8hsa-miR-224CAAGUCACUAGUGGUUCCGUUUA
miR-30-5p1771841A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-381127012761Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-542-5p6546601Ahsa-miR-542-5pUCGGGGAUCAUCAUGUCACGAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.