Gene Page: IGFBP3

Summary
GeneID  3486
Symbol  IGFBP3
Synonyms  BP-53|IBP3
Description  insulin-like growth factor binding protein 3
See related  HGNC:5472|MIM:146732|Ensembl:ENSG00000146674|HPRD:00899|
Locus tag  tcag7.703
Gene type  protein-coding
Map location  7p13-p12
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005520insulin-like growth factor bindingIEA-
GO:0008160protein tyrosine phosphatase activator activityIDA11940579 
GO:0031994insulin-like growth factor I bindingIPI10766744 
GO:0046872metal ion bindingNAS14576163 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001558regulation of cell growthIEA-
GO:0001933negative regulation of protein amino acid phosphorylationIDA17591901 
GO:0009968negative regulation of signal transductionNAS11940579 
GO:0014912negative regulation of smooth muscle cell migrationIDA10766744 
GO:0043065positive regulation of apoptosisIMP11971816 
GO:0045663positive regulation of myoblast differentiationIDA12599210 
GO:0048662negative regulation of smooth muscle cell proliferationIDA10766744 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005576extracellular regionNAS14718574 
GO:0005615extracellular spaceIEA-
GO:0005634nucleusIDA17434920 
GO:0016942insulin-like growth factor binding protein complexIC10766744 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ADAM12MCMP | MCMPMltna | MLTN | MLTNAADAM metallopeptidase domain 12-HPRD,BioGRID10849447 
CD44CDW44 | CSPG8 | ECMR-III | HCELL | IN | LHR | MC56 | MDU2 | MDU3 | MGC10468 | MIC4 | MUTCH-I | Pgp1CD44 molecule (Indian blood group)-HPRD,BioGRID12127836 
COL1A1OI4collagen, type I, alpha 1-HPRD,BioGRID12735930 
FN1CIG | DKFZp686F10164 | DKFZp686H0342 | DKFZp686I1370 | DKFZp686O13149 | ED-B | FINC | FN | FNZ | GFND | GFND2 | LETS | MSFfibronectin 1-HPRD,BioGRID11344214 
GTF3C1DKFZp686A111 | TFIIIC | TFIIIC220 | TFIIICalphageneral transcription factor IIIC, polypeptide 1, alpha 220kDaTwo-hybridBioGRID16169070 
IGF1IGFIinsulin-like growth factor 1 (somatomedin C)-HPRD,BioGRID11600567 
IGF-I interacts with IGFBP-3.BIND10407151 
IGF1RCD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216insulin-like growth factor 1 receptor-HPRD,BioGRID9389554 
IGF2C11orf43 | FLJ22066 | FLJ44734 | INSIGF | pp9974insulin-like growth factor 2 (somatomedin A)Reconstituted ComplexBioGRID11600567 |11749962 
IGF-II interacts with IGFBP-3.BIND10407151 
IGFALSALSinsulin-like growth factor binding protein, acid labile subunit-HPRD,BioGRID9446566 |9497324 
KLK3APS | KLK2A1 | PSA | hK3kallikrein-related peptidase 3-HPRD,BioGRID1383255 |10511594 
KLKB1KLK3 | PPKkallikrein B, plasma (Fletcher factor) 1-HPRD10226805 
LTBP1MGC163161latent transforming growth factor beta binding protein 1-HPRD12962157 
PAPPA2PAPP-A2 | PAPPE | PLAC3pappalysin 2-HPRD,BioGRID11264294 
PLGDKFZp779M0222plasminogen-HPRD,BioGRID9688635 
POLA2FLJ21662 | FLJ37250polymerase (DNA directed), alpha 2 (70kD subunit)Two-hybridBioGRID16169070 
RXRAFLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1retinoid X receptor, alpha-HPRD,BioGRID10874028 
TFDKFZp781D0156 | PRO1557 | PRO2086transferrin-HPRD,BioGRID11297622 |11749962 
 
KEGG Pathway Info
hsa04115: p53 signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1943501A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-34/44955611Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-381112211281Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.