Gene Page: IL10

Summary
GeneID  3586
Symbol  IL10
Synonyms  CSIF|IL-10|IL10A|MGC126450|MGC126451|TGIF
Description  interleukin 10
See related  HGNC:5962|MIM:124092|Ensembl:ENSG00000136634|HPRD:00495|
Locus tag  -
Gene type  protein-coding
Map location  1q31-q32
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies3Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005125cytokine activityIEA-
GO:0005141interleukin-10 receptor bindingNAS1847510 
GO:0005515protein bindingIPI11485736 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0002237response to molecule of bacterial originIDA17449476 
GO:0002740negative regulation of cytokine secretion during immune responseIDA10443688 
GO:0006916anti-apoptosisNAS8312229 
GO:0006954inflammatory responseNAS9463379 
GO:0006955immune responseIEA-
GO:0007253cytoplasmic sequestering of NF-kappaBNAS10975994 
GO:0007267cell-cell signalingIC1847510 
GO:0010468regulation of gene expressionIDA9184696 
GO:0030097hemopoiesisTAS11244051 
GO:0030183B cell differentiationNAS8228801 
GO:0030595leukocyte chemotaxisTAS9405662 
GO:0030886negative regulation of myeloid dendritic cell activationIEAdendrite (GO term level: 8)-
GO:0032695negative regulation of interleukin-12 productionIEA-
GO:0032715negative regulation of interleukin-6 productionIDA10443688 
GO:0032800receptor biosynthetic processIDANeurotransmitter (GO term level: 5)10443688 
GO:0042092T-helper 2 type immune responseTAS11244051 
GO:0042100B cell proliferationNAS8228801 
GO:0042130negative regulation of T cell proliferationNAS8499633 
GO:0042742defense response to bacteriumIEA-
GO:0045191regulation of isotype switchingNAS8228801 
GO:0045347negative regulation of MHC class II biosynthetic processTAS11244051 
GO:0045348positive regulation of MHC class II biosynthetic processIEA-
GO:0045355negative regulation of interferon-alpha biosynthetic processNAS9637497 
GO:0050715positive regulation of cytokine secretionIDA10443688 
GO:0051384response to glucocorticoid stimulusIDA10443688 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionNAS1847510 
GO:0005615extracellular spaceIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
A2MCPAMD5 | DKFZp779B086 | FWP007 | S863-7alpha-2-macroglobulin-HPRD,BioGRID10714547 
IL10CSIF | IL-10 | IL10A | MGC126450 | MGC126451 | TGIFinterleukin 10-HPRD,BioGRID7759550 |8590020 
|11717514 
IL10RACDW210A | HIL-10R | IL-10R1 | IL10Rinterleukin 10 receptor, alphaCo-crystal Structure
Co-purification
Reconstituted Complex		BioGRID7759550 |8248239 
|10231374 |11485736 
|11717514 
-HPRD7759550 |8248239 
|8897595 |10231374 
|11485736 |11717514 
IL10RBCDW210B | CRF2-4 | CRFB4 | D21S58 | D21S66 | IL-10R2interleukin 10 receptor, beta-HPRD9312047 |11485736 
 
KEGG Pathway Info
hsa04060: Cytokine-cytokine receptor interaction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04630: Jak-STAT signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04660: T cell receptor signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05310: Asthma - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05320: Autoimmune thyroid disease - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05322: Systemic lupus erythematosus - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05330: Allograft rejection - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/981401461Ahsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-271781841Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-361135141m8hsa-miR-361brainUUAUCAGAAUCUCCAGGGGUAC
miR-369-3p2052111Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-3742052121A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.