Gene Page: ITGA7

Summary
GeneID  3679
Symbol  ITGA7
Synonyms  FLJ25220
Description  integrin, alpha 7
See related  HGNC:6143|MIM:600536|Ensembl:ENSG00000135424|HPRD:02761|
Locus tag  -
Gene type  protein-coding
Map location  12q13
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
ExpressionExpressionP value: 1.747 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007155cell adhesionIEA-
GO:0007160cell-matrix adhesionTAS9354797 
GO:0007229integrin-mediated signaling pathwayIEA-
GO:0007517muscle developmentTAS9354797 |9590299 
GO:0008360regulation of cell shapeIEA-
GO:0048514blood vessel morphogenesisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0008305integrin complexIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CHRNA1ACHRA | ACHRD | CHRNA | CMS2A | FCCMS | SCCMScholinergic receptor, nicotinic, alpha 1 (muscle)-HPRD,BioGRID10910772 
FHL2AAG11 | DRAL | SLIM3four and a half LIM domains 2Affinity Capture-Western
Co-localization
Two-hybrid		BioGRID15117962 
FHL3MGC19547 | MGC23614 | MGC8696 | SLIM2four and a half LIM domains 3Affinity Capture-Western
Co-localization
Two-hybrid		BioGRID15117962 
 
KEGG Pathway Info
hsa04510: Focal adhesion - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04512: ECM-receptor interaction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04810: Regulation of actin cytoskeleton - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.13403471A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5063393461A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.