Gene Page: KCNK2

Summary
GeneID  3776
Symbol  KCNK2
Synonyms  K2p2.1|MGC126742|MGC126744|TPKC1|TREK|TREK-1|TREK1|hTREK-1c|hTREK-1e
Description  potassium channel, subfamily K, member 2
See related  HGNC:6277|MIM:603219|Ensembl:ENSG00000082482|
Locus tag  -
Gene type  protein-coding
Map location  1q41
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
ExpressionExpressionP value: 1.399 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005216ion channel activityIEA-
GO:0005244voltage-gated ion channel activityIEA-
GO:0005267potassium channel activityIEA-
GO:0015271outward rectifier potassium channel activityNAS-
GO:0030955potassium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
GO:0006813potassium ion transportIEA-
GO:0006813potassium ion transportNAS-
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0008076voltage-gated potassium channel complexIEA-
GO:0016020membraneIEA-
GO:0016020membraneNAS-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1474480m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5064734801A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-128190419101Ahsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-132/212257263m8hsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-1832842911A,m8hsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-19127912861A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-200bc/429842848m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-218134513511Ahsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-24374380m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-27190419111A,m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-3385976031Ahsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.