Gene Page: KPNA3

Summary
GeneID  3839
Symbol  KPNA3
Synonyms  IPOA4|SRP1gamma|SRP4|hSRP1
Description  karyopherin alpha 3 (importin alpha 4)
See related  HGNC:6396|MIM:601892|Ensembl:ENSG00000102753|HPRD:03536|
Locus tag  RP11-432M24.3
Gene type  protein-coding
Map location  13q14.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0005515protein bindingIPI15057270 |17353931 |17981117 
GO:0008139nuclear localization sequence bindingTAS9435235 
GO:0008565protein transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006461protein complex assemblyTAS9435235 
GO:0006607NLS-bearing substrate import into nucleusTAS9435235 
GO:0006886intracellular protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005643nuclear poreTAS9154134 
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARRB1ARB1 | ARR1arrestin, beta 1Affinity Capture-MSBioGRID17353931 
ARRB2ARB2 | ARR2 | BARR2 | DKFZp686L0365arrestin, beta 2Affinity Capture-MSBioGRID17353931 
FAM50BD6S2654E | X5Lfamily with sequence similarity 50, member BTwo-hybridBioGRID16189514 
HNRNPCC1 | C2 | HNRNP | HNRPC | MGC104306 | MGC105117 | MGC117353 | MGC131677 | SNRPCheterogeneous nuclear ribonucleoprotein C (C1/C2)Two-hybridBioGRID16189514 
KPNB1IMB1 | IPOB | Impnb | MGC2155 | MGC2156 | MGC2157 | NTF97karyopherin (importin) beta 1Reconstituted ComplexBioGRID9435235 |10523667 
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1Affinity Capture-MSBioGRID14743216 
RCC1CHC1 | RCC1-Iregulator of chromosome condensation 1-HPRD,BioGRID10744690 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-101104510511Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-103/107230323091Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-124/50618441850m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-128151215181Ahsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-134141147m8hsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-135130136m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-138111411201Ahsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-141/200a23272333m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-144104510511Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-15/16/195/424/497245924651Ahsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-17-5p/20/93.mr/106/519.d23072313m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-1821551621A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-186185418601Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-188146214691A,m8hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-19210021071A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-208105710631Ahsa-miR-208AUAAGACGAGCAAAAAGCUUGU
miR-214757763m8hsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-2235245311A,m8hsa-miR-223UGUCAGUUUGUCAAAUACCCC
miR-23145714631Ahsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-24428434m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-268218271Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-2715121518m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-30-5p10411047m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-32310961102m8hsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-324-3p127012761Ahsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
miR-3314471453m8hsa-miR-33GUGCAUUGUAGUUGCAUUG
hsa-miR-33bGUGCAUUGCUGUUGCAUUGCA
miR-38116571663m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-409-5p107910851Ahsa-miR-409-5pAGGUUACCCGAGCAACUUUGCA
hsa-miR-409-5pAGGUUACCCGAGCAACUUUGCA
miR-4313703761Ahsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-448190196m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-455181718231Ahsa-miR-455UAUGUGCCUUUGGACUACAUCG
miR-499105610631A,m8hsa-miR-499UUAAGACUUGCAGUGAUGUUUAA
miR-500414420m8hsa-miR-500AUGCACCUGGGCAAGGAUUCUG
miR-503245924651Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
miR-53917791785m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-542-3p139914061A,m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
miR-961561621Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.