Gene Page: INSC

Summary
GeneID  387755
Symbol  INSC
Synonyms  -
Description  inscuteable homolog (Drosophila)
See related  HGNC:33116|MIM:610668|Ensembl:ENSG00000188487|
Locus tag  -
Gene type  protein-coding
Map location  11p15.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007275multicellular organismal developmentIEA-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1864564621Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-31316322m8hsa-miR-31AGGCAAGAUGCUGGCAUAGCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.