Gene Page: RHOC

Summary
GeneID  389
Symbol  RHOC
Synonyms  ARH9|ARHC|H9|MGC1448|MGC61427|RHOH9
Description  ras homolog gene family, member C
See related  HGNC:669|MIM:165380|Ensembl:ENSG00000155366|HPRD:01322|
Locus tag  RP11-426L16.4
Gene type  protein-coding
Map location  1p13.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0235 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityTAS8468062 
GO:0004871signal transducer activityIMP12761501 
GO:0005515protein bindingIPI15670823 |17353931 
GO:0005525GTP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007264small GTPase mediated signal transductionIEA-
GO:0043123positive regulation of I-kappaB kinase/NF-kappaB cascadeIMP12761501 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005886plasma membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGAP1CDC42GAP | RHOGAP | RHOGAP1 | p50rhoGAPRho GTPase activating protein 1Two-hybridBioGRID16189514 
ARHGDIAGDIA1 | MGC117248 | RHOGDI | RHOGDI-1Rho GDP dissociation inhibitor (GDI) alphaAffinity Capture-MSBioGRID17353931 
CITCRIK | KIAA0949 | STK21citron (rho-interacting, serine/threonine kinase 21)Two-hybridBioGRID8543060 
RTKN-rhotekin-HPRD8662891 
VHLHRCA1 | RCA1 | VHL1von Hippel-Lindau tumor suppressorAffinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1382632701A,m8hsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-142-5p2702771A,m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-17-5p/20/93.mr/106/519.d2682751A,m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-93.hd/291-3p/294/295/302/372/373/520267273m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.