Gene Page: STMN1

Summary
GeneID  3925
Symbol  STMN1
Synonyms  LAP18|Lag|OP18|PP17|PP19|PR22|SMN
Description  stathmin 1/oncoprotein 18
See related  HGNC:6510|MIM:151442|Ensembl:ENSG00000117632|HPRD:01047|
Locus tag  RP1-125I3.5
Gene type  protein-coding
Map location  1p36.1-p35
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004871signal transducer activityTAS2917975 |8003023 
GO:0005515protein bindingIPI15652749 
GO:0015631tubulin bindingIDA10675326 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007019microtubule depolymerizationIDA9880330 
GO:0007052mitotic spindle organizationIDA9271428 
GO:0007242intracellular signaling cascadeIEA-
GO:0007242intracellular signaling cascadeTAS2917975 
GO:0007275multicellular organismal developmentIEA-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIDA11256614 
GO:0005737cytoplasmIEA-
GO:0005874microtubuleIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CDKN1BCDKN4 | KIP1 | MEN1B | MEN4 | P27KIP1cyclin-dependent kinase inhibitor 1B (p27, Kip1)p27 interacts with stathmin.BIND15652749 
HSPA5BIP | FLJ26106 | GRP78 | MIF2heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)-HPRD,BioGRID7724523 |10197448 
HSPA8HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71heat shock 70kDa protein 8-HPRD,BioGRID10197448 
TRPC5TRP5transient receptor potential cation channel, subfamily C, member 5Affinity Capture-WesternBioGRID12858178 
UHMK1KIS | KistU2AF homology motif (UHM) kinase 1-HPRD7724523 
 
KEGG Pathway Info
hsa04010: MAPK signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1935965m8hsa-miR-193aAACUGGCCUACAAAGUCCCAG
hsa-miR-193bAACUGGCCCUCAAAGUCCCGCUUU
miR-2231218m8hsa-miR-223UGUCAGUUUGUCAAAUACCCC
miR-224456462m8hsa-miR-224CAAGUCACUAGUGGUUCCGUUUA
miR-264154211Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-324-3p4524591A,m8hsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
miR-4526866931A,m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-945511Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.