Gene Page: ARNTL

Summary
GeneID  406
Symbol  ARNTL
Synonyms  BMAL1|BMAL1c|JAP3|MGC47515|MOP3|PASD3|TIC|bHLHe5
Description  aryl hydrocarbon receptor nuclear translocator-like
See related  HGNC:701|MIM:602550|Ensembl:ENSG00000133794|HPRD:03973|
Locus tag  -
Gene type  protein-coding
Map location  11p15
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0004871signal transducer activityIEA-
GO:0017162aryl hydrocarbon receptor bindingIPI9079689 
GO:0051879Hsp90 protein bindingIDA9079689 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007165signal transductionIEA-
GO:0007623circadian rhythmTAS9616112 
GO:0045944positive regulation of transcription from RNA polymerase II promoterIGI9576906 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005667transcription factor complexIPI9576906 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AHR-aryl hydrocarbon receptor-HPRD,BioGRID9079689 
BHLHB2DEC1 | SHARP-2 | STRA13 | Stra14 | bHLHe40basic helix-loop-helix domain containing, class B, 2-HPRD12397359 
CLOCKKAT13D | KIAA0334 | bHLHe8clock homolog (mouse)Two-hybridBioGRID11439184 |14701734 
-HPRD9989497 
CRY1PHLL1cryptochrome 1 (photolyase-like)-HPRD,BioGRID10531061 
CSNK1EHCKIE | MGC10398casein kinase 1, epsilon-HPRD,BioGRID11875063 
EP300KAT3B | p300E1A binding protein p300Reconstituted ComplexBioGRID14645221 
EPAS1ECYT4 | HIF2A | HLF | MOP2 | PASD2endothelial PAS domain protein 1-HPRD,BioGRID9576906 
HIF1AHIF-1alpha | HIF1 | HIF1-ALPHA | MOP1 | PASD8hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)-HPRD,BioGRID9576906 
HSP90AA1FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2heat shock protein 90kDa alpha (cytosolic), class A member 1-HPRD,BioGRID9079689 
KAT2BCAF | P | P/CAF | PCAFK(lysine) acetyltransferase 2BReconstituted ComplexBioGRID14645221 
NPAS2FLJ23138 | MGC71151 | MOP4 | PASD4 | bHLHe9neuronal PAS domain protein 2in vitro
in vivo
Two-hybrid
BioGRID9576906 |11439184 
NPAS4Le-PAS | NXF | PASD10neuronal PAS domain protein 4-HPRD,BioGRID14701734 
RARANR1B1 | RARretinoic acid receptor, alphaReconstituted ComplexBioGRID11439184 
RXRAFLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1retinoid X receptor, alphaReconstituted ComplexBioGRID11439184 
 
KEGG Pathway Info
hsa04710: Circadian rhythm - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a193199m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-142-3p3523591A,m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-1533173231Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-1552382441Ahsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
miR-203.13293351Ahsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-2765711Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-3812452511Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-4483163231A,m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-494490496m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-5052672741A,m8hsa-miR-505GUCAACACUUGCUGGUUUCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.