Gene Page: ATXN3

Summary
GeneID  4287
Symbol  ATXN3
Synonyms  AT3|ATX3|JOS|MJD|MJD1|SCA3
Description  ataxin 3
See related  HGNC:7106|MIM:607047|Ensembl:ENSG00000066427|HPRD:06131|
Locus tag  -
Gene type  protein-coding
Map location  14q24.3-q32.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0248 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI16713569 
GO:0016787hydrolase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006289nucleotide-excision repairTAS10915768 
GO:0006350transcriptionIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)7655453 
GO:0007399nervous system developmentTASneurite (GO term level: 5)9124802 
GO:0008219cell deathIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005654nucleoplasmTAS9580663 
GO:0005737cytoplasmTAS9124802 
GO:0016363nuclear matrixIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CASP1ICE | IL1BC | P45caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)Ataxin-3 interacts with caspase 1. This interaction was modeled on a demonstrated interaction between human ataxin-3 and caspase 1 from an unspecified species.BIND9535906 
-HPRD9535906 
CASP3CPP32 | CPP32B | SCA-1caspase 3, apoptosis-related cysteine peptidaseAtaxin-3 interacts with caspase 3. This interaction was modeled on a demonstrated interaction between human ataxin-3 and caspase 3 from an unspecified species.BIND9535906 
RAD23AHHR23A | MGC111083RAD23 homolog A (S. cerevisiae)Ataxin-3 interacts with HHR23A.BIND10915768 
-HPRD,BioGRID10915768 
RAD23BHHR23B | HR23B | P58RAD23 homolog B (S. cerevisiae)-HPRD,BioGRID10915768 
Ataxin-3 interacts with HHR23B.BIND10915768 
VCPIBMPFD | MGC131997 | MGC148092 | MGC8560 | TERA | p97valosin-containing protein-HPRD,BioGRID12944474 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/351148814941Ahsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-134118511911Ahsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-25/32/92/363/3672592661A,m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-91901961Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.