Gene Page: MLL

Summary
GeneID  4297
Symbol  MLL
Synonyms  ALL-1|CXXC7|FLJ11783|HRX|HTRX1|KMT2A|MLL/GAS7|MLL1A|TET1-MLL|TRX1
Description  myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)
See related  HGNC:7132|MIM:159555|Ensembl:ENSG00000118058|HPRD:01162|
Locus tag  hCG_1732268
Gene type  protein-coding
Map location  11q23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.006 
ExpressionExpressionP value: 1.597 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003676nucleic acid bindingIEA-
GO:0003677DNA bindingIEA-
GO:0003700transcription factor activityNAS10821850 
GO:0003702RNA polymerase II transcription factor activityTAS10821850 
GO:0005515protein bindingIEA-
GO:0008168methyltransferase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0016740transferase activityIEA-
GO:0018024histone-lysine N-methyltransferase activityIEA-
GO:0042803protein homodimerization activityIDA11313484 
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006366transcription from RNA polymerase II promoterTAS10821850 
GO:0006461protein complex assemblyIDA15199122 
GO:0006915apoptosisIEA-
GO:0016568chromatin modificationIEA-
GO:0035162embryonic hemopoiesisTAS15618964 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA15640349 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ASH2LASH2 | ASH2L1 | ASH2L2 | Bre2ash2 (absent, small, or homeotic)-like (Drosophila)Affinity Capture-Western
Co-purification
BioGRID15199122 
AVPADH | ARVP | AVP-NPII | AVRP | VParginine vasopressinBiochemical ActivityBioGRID14607844 
BMI1MGC12685 | PCGF4 | RNF51BMI1 polycomb ring finger oncogene-HPRD,BioGRID12829790 
CBX4NBP16 | PC2 | hPC2chromobox homolog 4 (Pc class homolog, Drosophila)Reconstituted ComplexBioGRID12829790 
CREBBPCBP | KAT3A | RSTSCREB binding protein-HPRD,BioGRID11259575 |12205094 
CTBP1BARS | MGC104684C-terminal binding protein 1Affinity Capture-Western
Reconstituted Complex
BioGRID12829790 
FASLGAPT1LG1 | CD178 | CD95L | FASL | TNFSF6Fas ligand (TNF superfamily, member 6)-HPRD12023017 
HCFC1CFF | HCF-1 | HCF1 | HFC1 | MGC70925 | VCAFhost cell factor C1 (VP16-accessory protein)Affinity Capture-Western
Co-purification
BioGRID15199122 
HCFC2FLJ94012 | HCF-2 | HCF2host cell factor C2Affinity Capture-Western
Co-purification
BioGRID15199122 
HDAC1DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1histone deacetylase 1Affinity Capture-Western
Reconstituted Complex
BioGRID12829790 
HOXA9ABD-B | HOX1 | HOX1.7 | HOX1G | MGC1934homeobox A9MLL1 interacts with HOXA9 promoter.BIND15960974 
MLL1 interacts with HOXA9.BIND15960974 
HOXC8HOX3 | HOX3Ahomeobox C8MLL1 interacts with HOXC8 promoter.BIND15960974 
MLL1 interacts with HOXC8.BIND15960974 
INSILPR | IRDNinsulinBiochemical ActivityBioGRID14607844 
MAP3K5ASK1 | MAPKKK5 | MEKK5mitogen-activated protein kinase kinase kinase 5Affinity Capture-WesternBioGRID14607843 
MEN1MEAI | SCG2multiple endocrine neoplasia IAffinity Capture-Western
Co-purification
BioGRID15199122 
MLLALL-1 | CXXC7 | FLJ11783 | HRX | HTRX1 | KMT2A | MLL/GAS7 | MLL1A | TET1-MLL | TRX1myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)-HPRD,BioGRID11313484 |12393701 
|12482972 
MYST1FLJ14040 | KAT8 | MOF | hMOFMYST histone acetyltransferase 1MOF interacts with MLL.BIND15960975 
OXTMGC126890 | MGC126892 | OT | OT-NPIoxytocin, prepropeptideBiochemical ActivityBioGRID14607844 
PLXNB1KIAA0407 | MGC149167 | PLEXIN-B1 | PLXN5 | SEPplexin B1-HPRD12123608 
PPIECYP-33 | MGC111222 | MGC3736peptidylprolyl isomerase E (cyclophilin E)-HPRD,BioGRID11313484 
PPP1R15AGADD34protein phosphatase 1, regulatory (inhibitor) subunit 15A-HPRD,BioGRID10490642 
RBBP5RBQ3 | SWD1retinoblastoma binding protein 5RbBP5 interacts with MLL.BIND15960975 
Affinity Capture-Western
Co-purification
BioGRID15199122 
RNF2BAP-1 | BAP1 | DING | HIPI3 | RING1B | RING2ring finger protein 2Ring2 interacts with MLL.BIND15960975 
SMARCB1BAF47 | INI1 | RDT | SNF5 | SNF5L1 | Sfh1p | Snr1 | hSNFSSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1Affinity Capture-WesternBioGRID10490642 
TAF9AD-004 | AK6 | CGI-137 | CINAP | CIP | MGC1603 | MGC3647 | MGC5067 | MGC:1603 | MGC:3647 | MGC:5067 | TAF2G | TAFII31 | TAFII32 | TAFIID32TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa-HPRD10821850 
WDR5BIG-3 | SWD3WD repeat domain 5WDR5 interacts with MLL. This interaction was modeled on a demonstrated interaction between WDR5 from an unspecified species and human MLL.BIND15960975 
Affinity Capture-Western
Co-purification
BioGRID15199122 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-10126892695m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-124/50622192225m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-128269126971Ahsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-130/30124862492m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-136236023661Ahsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-137216721741A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-142-3p12421248m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-148/152258325901A,m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-1505375441A,m8hsa-miR-150UCUCCCAACCCUUGUACCAGUG
miR-182285728641A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-19326242630m8hsa-miR-193aAACUGGCCUACAAAGUCCCAG
hsa-miR-193bAACUGGCCCUCAAAGUCCCGCUUU
miR-21820312037m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-221/2229549611A,m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-2726912697m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-30-5p136413711A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-338227922851Ahsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-34224932499m8hsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-369-3p14781484m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37023722378m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-37724922498m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-380-5p280828151A,m8hsa-miR-380-5pUGGUUGACCAUAGAACAUGCGC
hsa-miR-563AGGUUGACAUACGUUUCCC
miR-381140814141Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-49412901296m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-495256325691Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-496139514011Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-93.hd/291-3p/294/295/302/372/373/520144514521A,m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
miR-96285828641Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.