Gene Page: MSN

Summary
GeneID  4478
Symbol  MSN
Synonyms  -
Description  moesin
See related  HGNC:7373|MIM:309845|Ensembl:ENSG00000147065|HPRD:02399|
Locus tag  -
Gene type  protein-coding
Map location  Xq11.2-q12
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.004 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingIPINeurotransmitter (GO term level: 4)15819698 
GO:0005200structural constituent of cytoskeletonTAS1924289 
GO:0008092cytoskeletal protein bindingIEA-
GO:0050839cell adhesion molecule bindingIPI12082081 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006928cell motionTAS16130169 
GO:0007159leukocyte adhesionIEP12082081 
GO:0022614membrane to membrane dockingIEP12082081 
GO:0050900leukocyte migrationIEP12082081 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0001931uropodIEASynap (GO term level: 5)-
GO:0005737cytoplasmIEA-
GO:0005856cytoskeletonTAS16130169 
GO:0005886plasma membraneTAS1924289 |8188263 
GO:0005902microvillusIDA12082081 
GO:0016323basolateral plasma membraneIEA-
GO:0016324apical plasma membraneIEA-
GO:0019898extrinsic to membraneIEA-
GO:0030175filopodiumIDAaxon (GO term level: 5)12082081 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGDIAGDIA1 | MGC117248 | RHOGDI | RHOGDI-1Rho GDP dissociation inhibitor (GDI) alphaCo-purificationBioGRID15659383 
BIDFP497 | MGC15319 | MGC42355BH3 interacting domain death agonistCo-purificationBioGRID15659383 
CASP10ALPS2 | FLICE2 | MCH4caspase 10, apoptosis-related cysteine peptidaseCo-purificationBioGRID15659383 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidaseCo-purificationBioGRID15659383 
CD46MCP | MGC26544 | MIC10 | TLX | TRA2.10CD46 molecule, complement regulatory protein-HPRD7884872|12082081 
-HPRD,BioGRID7884872 
CD93C1QR1 | C1qR(P) | C1qRP | CDw93 | MXRA4 | dJ737E23.1CD93 moleculeMoesin interacts with CD93.BIND15819698 
EZRCVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2ezrin-HPRD,BioGRID7579708 |8248180 
FADDGIG3 | MGC8528 | MORT1Fas (TNFRSF6)-associated via death domainCo-purificationBioGRID15659383 
FASALPS1A | APO-1 | APT1 | CD95 | FAS1 | FASTM | TNFRSF6Fas (TNF receptor superfamily, member 6)Co-purificationBioGRID15659383 
FASLGAPT1LG1 | CD178 | CD95L | FASL | TNFSF6Fas ligand (TNF superfamily, member 6)Co-purificationBioGRID15659383 
HLA-BAS | HLA-B-7301 | HLA-B73 | HLAB | HLAC | SPDA1major histocompatibility complex, class I, BAffinity Capture-MSBioGRID17353931 
ICAM1BB2 | CD54 | P3.58intercellular adhesion molecule 1-HPRD12082081 
ICAM2CD102intercellular adhesion molecule 2-HPRD,BioGRID9472040 
ICAM3CD50 | CDW50 | ICAM-Rintercellular adhesion molecule 3-HPRD,BioGRID11784723 
L1CAMCAML1 | CD171 | HSAS | HSAS1 | MASA | MIC5 | N-CAML1 | S10 | SPG1L1 cell adhesion molecule-HPRD12070130 
MAPK8JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1mitogen-activated protein kinase 8Co-purificationBioGRID15659383 
MSN-moesin-HPRD,BioGRID10847681 
NCF1FLJ79451 | NCF1A | NOXO2 | SH3PXD1A | p47phoxneutrophil cytosolic factor 1Affinity Capture-Western
Reconstituted Complex
BioGRID11716484 
NCF4MGC3810 | NCF | P40PHOX | SH3PXD4neutrophil cytosolic factor 4, 40kDa-HPRD,BioGRID11716484 
PLEC1EBS1 | EBSO | HD1 | PCN | PLEC1b | PLTNplectin 1, intermediate filament binding protein 500kDa-HPRD,BioGRID11441066 
RHOAARH12 | ARHA | RHO12 | RHOH12ras homolog gene family, member ACo-purificationBioGRID15659383 
SELLCD62L | LAM-1 | LAM1 | LECAM1 | LNHR | LSEL | LYAM1 | Leu-8 | Lyam-1 | PLNHR | TQ1 | hLHRcselectin LReconstituted ComplexBioGRID11706008 
SELPLGCD162 | CLA | PSGL-1 | PSGL1selectin P ligand-HPRD,BioGRID12115638 
SLC9A3R1EBP50 | NHERF | NHERF1 | NPHLOP2solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1moesin interacts with hNHE-RF.BIND9430655 
-HPRD,BioGRID9430655 
SPNCD43 | GPL115 | LSNsialophorin-HPRD,BioGRID9616160 
SYKDKFZp313N1010 | FLJ25043 | FLJ37489spleen tyrosine kinaseSyk interacts with moesin. This interaction was modeled on a demonstrated interaction between Syk and moesin from unspecified species.BIND12387735 
TNFRSF10BCD262 | DR5 | KILLER | KILLER/DR5 | TRAIL-R2 | TRAILR2 | TRICK2 | TRICK2A | TRICK2B | TRICKB | ZTNFR9tumor necrosis factor receptor superfamily, member 10bCo-purificationBioGRID15659383 
TNFRSF1ACD120a | FPF | MGC19588 | TBP1 | TNF-R | TNF-R-I | TNF-R55 | TNFAR | TNFR1 | TNFR55 | TNFR60 | p55 | p55-R | p60tumor necrosis factor receptor superfamily, member 1ACo-purificationBioGRID15659383 
TSC1KIAA0243 | LAM | MGC86987 | TSCtuberous sclerosis 1-HPRD,BioGRID12226091 
Hamartin interacts with moesin. This interaction was modeled on a demonstrated interaction between murine hamartin and human moesin.BIND10806479 
VCAM1CD106 | DKFZp779G2333 | INCAM-100 | MGC99561vascular cell adhesion molecule 1-HPRD,BioGRID12082081 
-HPRD7884872|12082081 
 
KEGG Pathway Info
hsa04670: Leukocyte transendothelial migration - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04810: Regulation of actin cytoskeleton - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1224854m8hsa-miR-122aUGGAGUGUGACAAUGGUGUUUGU
miR-1331401471A,m8hsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-192/21516011607m8hsa-miR-192CUGACCUAUGAAUUGACAGCC
hsa-miR-215AUGACCUAUGAAUUGACAGAC
miR-200bc/429157415811A,m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-21717031709m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-27179418001Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-49143501A,m8hsa-miR-491brainAGUGGGGAACCCUUCCAUGAGGA
miR-9620122018m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.