Gene Page: NFATC4

Summary
GeneID  4776
Symbol  NFATC4
Synonyms  NF-ATc4|NFAT3
Description  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
See related  HGNC:7778|MIM:602699|Ensembl:ENSG00000100968|HPRD:09096|
Locus tag  -
Gene type  protein-coding
Map location  14q11.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0003713transcription coactivator activityTAS7749981 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006366transcription from RNA polymerase II promoterTAS7749981 
GO:0006954inflammatory responseTAS7749981 
GO:0007507heart developmentIEA-
GO:0045333cellular respirationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CREBBPCBP | KAT3A | RSTSCREB binding protein-HPRD,BioGRID11514544 
GATA4MGC126629GATA binding protein 4-HPRD,BioGRID9568714 
YWHAQ14-3-3 | 1C5 | HS1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide-HPRD,BioGRID10611249 
YWHAZKCIP-1 | MGC111427 | MGC126532 | MGC138156tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide-HPRD,BioGRID10611249 
 
KEGG Pathway Info
hsa04010: MAPK signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04310: Wnt signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04360: Axon guidance - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04370: VEGF signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04650: Natural killer cell mediated cytotoxicity - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04660: T cell receptor signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04662: B cell receptor signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29180186m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-32893991Ahsa-miR-328brainCUGGCCCUCUCUGCCCUUCCGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.