Gene Page: FXYD2

Summary
GeneID  486
Symbol  FXYD2
Synonyms  ATP1G1|HOMG2|MGC12372
Description  FXYD domain containing ion transport regulator 2
See related  HGNC:4026|MIM:601814|Ensembl:ENSG00000137731|HPRD:03487|
Locus tag  -
Gene type  protein-coding
Map location  11q23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005215transporter activityTAS9048881 
GO:0005216ion channel activityIEA-
GO:0005216ion channel activityNAS-
GO:0005391sodium:potassium-exchanging ATPase activityTAS9048881 
GO:0030955potassium ion bindingIEA-
GO:0031402sodium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
GO:0006811ion transportNAS-
GO:0006813potassium ion transportIEA-
GO:0006814sodium ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005890sodium:potassium-exchanging ATPase complexNAS-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2051291351Ahsa-miR-205UCCUUCAUUCCACCGGAGUCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.