Gene Page: NRAS

Summary
GeneID  4893
Symbol  NRAS
Synonyms  ALPS4|N-ras|NRAS1
Description  neuroblastoma RAS viral (v-ras) oncogene homolog
See related  HGNC:7989|MIM:164790|Ensembl:ENSG00000213281|HPRD:01273|
Locus tag  -
Gene type  protein-coding
Map location  1p13.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityIEA-
GO:0005515protein bindingIEA-
GO:0005525GTP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006897endocytosisIEA-
GO:0007265Ras protein signal transductionEXP11520933 
GO:0007265Ras protein signal transductionIEA-
GO:0007569cell agingIEA-
GO:0008284positive regulation of cell proliferationIEA-
GO:0008542visual learningIEA-
GO:0030036actin cytoskeleton organizationIEA-
GO:0032228regulation of synaptic transmission, GABAergicIEAneuron, GABA, Synap, Neurotransmitter (GO term level: 9)-
GO:0035022positive regulation of Rac protein signal transductionIEA-
GO:0043524negative regulation of neuron apoptosisIEAneuron (GO term level: 9)-
GO:0048169regulation of long-term neuronal synaptic plasticityIEAneuron, Synap (GO term level: 10)-
GO:0051146striated muscle cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005622intracellularIEA-
GO:0005624membrane fractionIEA-
GO:0005794Golgi apparatusIEA-
GO:0005886plasma membraneEXP7972015 |8493579 |9069260 
|9690470 
GO:0005886plasma membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGAP4C1 | KIAA0131 | RGC1 | RhoGAP4 | p115Rho GTPase activating protein 4-HPRD10655059 
BCL2Bcl-2B-cell CLL/lymphoma 2-HPRD10490827 
MLLT4AF-6 | AF6 | AFADIN | FLJ34371 | RP3-431P23.3myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4Affinity Capture-WesternBioGRID12808105 
PIK3CGPI3CG | PI3K | PI3Kgamma | PIK3phosphoinositide-3-kinase, catalytic, gamma polypeptideReconstituted ComplexBioGRID11136978 
PLCE1FLJ23659 | KIAA1516 | MGC167842 | NPHS3 | PLCEphospholipase C, epsilon 1Two-hybridBioGRID16169070 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1Nras interacts with Raf. This interaction was modelled on a demonstrated interaction between Nras and Raf, both from an unspecified species.BIND15705808 
Affinity Capture-WesternBioGRID10882715 
RAP1GDS1GDS1 | MGC118859 | MGC118861 | SmgGDSRAP1, GTP-GDP dissociation stimulator 1-HPRD,BioGRID11948427 
RASGRP2CALDAG-GEFI | CDC25LRAS guanyl releasing protein 2 (calcium and DAG-regulated)-HPRD10918068 
SHOC2FLJ60412 | KIAA0862 | SIAA0862 | SOC-2 | SOC2 | SUR-8 | SUR8soc-2 suppressor of clear homolog (C. elegans)-HPRD9674433 
 
KEGG Pathway Info
hsa04010: MAPK signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04012: ErbB signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04360: Axon guidance - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04370: VEGF signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04530: Tight junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04540: Gap junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04650: Natural killer cell mediated cytotoxicity - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04660: T cell receptor signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04662: B cell receptor signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04664: Fc epsilon RI signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04720: Long-term potentiation - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04730: Long-term depression - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04810: Regulation of actin cytoskeleton - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04910: Insulin signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04912: GnRH signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04916: Melanogenesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05211: Renal cell carcinoma - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05213: Endometrial cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05214: Glioma - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05215: Prostate cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05216: Thyroid cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05218: Melanoma - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05219: Bladder cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05220: Chronic myeloid leukemia - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05221: Acute myeloid leukemia - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05223: Non-small cell lung cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98186192m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-124/506640646m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-196185191m8hsa-miR-196aUAGGUAGUUUCAUGUUGUUGG
hsa-miR-196bUAGGUAGUUUCCUGUUGUUGG
miR-28116122m8hsa-miR-28brainAAGGAGCUCACAGUCUAUUGAG
miR-3262102161Ahsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-3619669721Ahsa-miR-361brainUUAUCAGAAUCUCCAGGGGUAC
miR-5054184241Ahsa-miR-505GUCAACACUUGCUGGUUUCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.