Gene Page: YBX1

Summary
GeneID  4904
Symbol  YBX1
Synonyms  BP-8|CSDA2|CSDB|DBPB|MDR-NF1|MGC104858|MGC110976|MGC117250|NSEP-1|NSEP1|YB-1|YB1
Description  Y box binding protein 1
See related  HGNC:8014|MIM:154030|Ensembl:ENSG00000065978|HPRD:01095|
Locus tag  -
Gene type  protein-coding
Map location  1p34
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0238 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003690double-stranded DNA bindingTAS1738588 
GO:0003697single-stranded DNA bindingTAS1738588 
GO:0003700transcription factor activityTAS3174636 
GO:0003723RNA bindingNAS-
GO:0005515protein bindingIPI12674497 |15229244 
GO:0016564transcription repressor activityNAS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000398nuclear mRNA splicing, via spliceosomeEXP12226669 
GO:0006350transcriptionIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006355regulation of transcription, DNA-dependentNAS-
GO:0006366transcription from RNA polymerase II promoterTAS3174636 
GO:0008380RNA splicingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusNAS-
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKT1AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHAv-akt murine thymoma viral oncogene homolog 1Akt-1 interacts with and phosphorylates YB-1.BIND15806160 
ANKRD2ARPP | MGC104314ankyrin repeat domain 2 (stretch responsive muscle)-HPRD,BioGRID15136035 
CTCF-CCCTC-binding factor (zinc finger protein)-HPRD,BioGRID10906122 
YB-1 interacts with CTCF.BIND10906122 
FUSCHOP | FUS-CHOP | FUS1 | TLS | TLS/CHOP | hnRNP-P2fusion (involved in t(12;16) in malignant liposarcoma)-HPRD,BioGRID12168660 
HNRNPKCSBP | FLJ41122 | HNRPK | TUNPheterogeneous nuclear ribonucleoprotein KYB-1 interacts with hnRNP K. This interaction was modeled on a demonstrated interaction between human hnRNP K and murineYB-1.BIND10809782 
IREB2ACO3 | FLJ23381 | IRP2 | IRP2ADiron-responsive element binding protein 2-HPRD,BioGRID12192037 
YB-1 interacts with IRP2.BIND12192037 
MVPLRP | VAULT1major vault proteinYB-1 interacts with the MVP promoterBIND15750632 
NFYBCBF-A | CBF-B | HAP3 | NF-YBnuclear transcription factor Y, beta-HPRD7651426 
PCNAMGC8367proliferating cell nuclear antigen-HPRD,BioGRID9927044 
PURAPUR-ALPHA | PUR1 | PURALPHApurine-rich element binding protein A-HPRD,BioGRID7862639 
YB-1 interacts with Pur-alpha.BIND10082537 
RNU11U11RNA, U11 small nuclearAffinity Capture-MSBioGRID15146077 
RNU12U12RNA, U12 small nuclearAffinity Capture-MSBioGRID15146077 
SFRS12DKFZp564B176 | MGC133045 | SRrp508 | SRrp86splicing factor, arginine/serine-rich 12-HPRD14559993 
SFRS9SRp30csplicing factor, arginine/serine-rich 9-HPRD,BioGRID12604611 
YB-1 interacts with SRp30c.BIND12604611 
TFAP2AAP-2 | AP-2alpha | AP2TF | BOFS | TFAP2transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)-HPRD,BioGRID9830047 |11973333 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD11175333 |11973333 
in vitro
in vivo
Reconstituted Complex
BioGRID11175333 |15136035 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-129-5p3513571Ahsa-miR-129brainCUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5pCUUUUUGCGGUCUGGGCUUGCU
miR-13766721Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-153157163m8hsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-2083893951Ahsa-miR-208AUAAGACGAGCAAAAAGCUUGU
miR-216293299m8hsa-miR-216UAAUCUCAGCUGGCAACUGUG
miR-30-5p3323381Ahsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-37579851Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-37917231Ahsa-miR-379brainUGGUAGACUAUGGAACGUA
miR-382336342m8hsa-miR-382brainGAAGUUGUUCGUGGUGGAUUCG
miR-488280286m8hsa-miR-488CCCAGAUAAUGGCACUCUCAA
miR-4942732791Ahsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-4993893951Ahsa-miR-499UUAAGACUUGCAGUGAUGUUUAA
miR-5392422481Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.