Gene Page: ATP2B2

Summary
GeneID  491
Symbol  ATP2B2
Synonyms  PMCA2|PMCA2a|PMCA2i
Description  ATPase, Ca++ transporting, plasma membrane 2
See related  HGNC:815|MIM:108733|Ensembl:ENSG00000157087|HPRD:00160|
Locus tag  -
Gene type  protein-coding
Map location  3p25.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0000287magnesium ion bindingIEA-
GO:0005388calcium-transporting ATPase activityNAS1313367 
GO:0005509calcium ion bindingIEA-
GO:0005516calmodulin bindingIEA-
GO:0005524ATP bindingIEA-
GO:0016787hydrolase activityIEA-
GO:0016820hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substancesIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006812cation transportIEA-
GO:0006816calcium ion transportIEA-
GO:0007605sensory perception of soundIMP15829536 
GO:0008152metabolic processIEA-
GO:0030182neuron differentiationIDAneuron (GO term level: 8)11259493 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIDA15765049 
GO:0005886plasma membraneNAS1313367 
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DLG1DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlgdiscs, large homolog 1 (Drosophila)PMCA2b interacts with SAP97.BIND11274188 
-HPRD,BioGRID11274188 
DLG2DKFZp781D1854 | DKFZp781E0954 | FLJ37266 | MGC131811 | PSD-93discs, large homolog 2, chapsyn-110 (Drosophila)PMCA2b interacts with SAP93. This interaction was modeled on a demonstrated interaction between human PMCA2b and SAP93 from rat and an unspecified source.BIND11274188 
-HPRD,BioGRID11274188 
DLG3KIAA1232 | MRX | MRX90 | NE-Dlg | NEDLG | SAP102discs, large homolog 3 (neuroendocrine-dlg, Drosophila)Affinity Capture-WesternBioGRID11274188 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)-HPRD11274188 
PMCA2b interacts with SAP90. This interaction was modeled on a demonstrated interaction between human PMCA2b and rat SAP90.BIND11274188 
PDZD11AIPP1 | PDZK11 | PISPPDZ domain containing 11-HPRD12763866 
PMCA2b interacts with PISP.BIND12763866 
SLC9A3R2E3KARP | MGC104639 | NHE3RF2 | NHERF-2 | NHERF2 | OCTS2 | SIP-1 | SIP1 | TKA-1solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2-HPRD11786550 
C-terminal tail of PMCA2b interacts with the PDZ domain of NHERF2.BIND11786550 
 
KEGG Pathway Info
hsa04020: Calcium signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-101149415001Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-127141014161Ahsa-miR-127brainUCGGAUCCGUCUGAGCUUGGCU
miR-130/30125972603m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-13515361542m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-13914951501m8hsa-miR-139brainUCUACAGUGCACGUGUCU
hsa-miR-139brainUCUACAGUGCACGUGUCU
miR-144149315001A,m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-15/16/195/424/49713551361m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-17-5p/20/93.mr/106/519.d16631669m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-1813263331A,m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-19559565m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-191955961m8hsa-miR-191brainCAACGGAAUCCCAAAAGCAGCU
miR-199848854m8hsa-miR-199aCCCAGUGUUCAGACUACCUGUUC
hsa-miR-199bCCCAGUGUUUAGACUAUCUGUUC
miR-203.1118211881Ahsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-299-5p146114671Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-30-5p7998061A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-326191519221A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-330172017271A,m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-363176817741Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-378248224891A,m8hsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-410601607m8hsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-4524204271A,m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-495394400m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-50512571263m8hsa-miR-505GUCAACACUUGCUGGUUUCCUC
miR-714721478m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
miR-93.hd/291-3p/294/295/302/372/373/52016621668m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.