Gene Page: PEX13

Summary
GeneID  5194
Symbol  PEX13
Synonyms  NALD|ZWS
Description  peroxisomal biogenesis factor 13
See related  HGNC:8855|MIM:601789|Ensembl:ENSG00000162928|HPRD:03475|
Locus tag  -
Gene type  protein-coding
Map location  2p14-p16
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI8858165 |9653144 |10704444 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001561fatty acid alpha-oxidationIEA-
GO:0001764neuron migrationIEAneuron (GO term level: 8)-
GO:0001967suckling behaviorIEA-
GO:0007626locomotory behaviorIEA-
GO:0015031protein transportIEA-
GO:0016560protein import into peroxisome matrix, dockingIMP8858165 
GO:0016560protein import into peroxisome matrix, dockingTAS10704444 
GO:0021795cerebral cortex cell migrationIEA-
GO:0060152microtubule-based peroxisome localizationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005624membrane fractionIDA8858165 
GO:0005777peroxisomeIEA-
GO:0005778peroxisomal membraneIDA16449325 
GO:0005779integral to peroxisomal membraneIDA8858165 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PEX13NALD | ZWSperoxisomal biogenesis factor 13PEX13 interacts with itself to form a homodimer.BIND12096124 
PEX14MGC12767 | NAPP2 | Pex14p | dJ734G22.2peroxisomal biogenesis factor 14Reconstituted ComplexBioGRID11865044 
PEX14 interacts with PEX13.BIND12096124 
-HPRD9094717 |10087260 
PEX19D1S2223E | HK33 | PMP1 | PMPI | PXF | PXMP1peroxisomal biogenesis factor 19PEX13 interacts with PEX19.BIND12096124 
-HPRD,BioGRID10704444 
PEX5FLJ50634 | FLJ50721 | FLJ51948 | PTS1-BP | PTS1R | PXR1peroxisomal biogenesis factor 5-HPRD,BioGRID8858165 |11865044 
PEX7PTS2R | RCDP1 | RDperoxisomal biogenesis factor 7-HPRD10087260 
Reconstituted ComplexBioGRID11865044 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/4971211281A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-4942142201Ahsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-5031221281Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.