Gene Page: PLXNA2

Summary
GeneID  5362
Symbol  PLXNA2
Synonyms  FLJ11751|FLJ30634|KIAA0463|OCT|PLXN2
Description  plexin A2
See related  HGNC:9100|MIM:601054|Ensembl:ENSG00000076356|HPRD:03033|
Locus tag  RP11-328D5.3
Gene type  protein-coding
Map location  1q32.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 31 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionIEA-
GO:0007275multicellular organismal developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DHX37DDX37 | FLJ41974 | KIAA1517 | MGC2695 | MGC4322 | MGC46245DEAH (Asp-Glu-Ala-His) box polypeptide 37-HPRD12421765 
HACE1-HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1-HPRD12421765 
IFT80ATD2 | KIAA1374 | MGC126543 | WDR56intraflagellar transport 80 homolog (Chlamydomonas)-HPRD12421765 
KIAA1199TMEM2LKIAA1199-HPRD12421765 
 
KEGG Pathway Info
hsa04360: Axon guidance - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-10149404946m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-137117411811A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-142-5p352358m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-145473047361Ahsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-15/16/195/424/497302308m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-199472847351A,m8hsa-miR-199aCCCAGUGUUCAGACUACCUGUUC
hsa-miR-199bCCCAGUGUUUAGACUAUCUGUUC
miR-214378037871A,m8hsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-26118011871A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-30-5p116411711A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-3120522058m8hsa-miR-31AGGCAAGAUGCUGGCAUAGCUG
miR-3269298m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-330305311m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-369-3p474047471A,m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37447414747m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-378210521111Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-410494849551A,m8hsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.