Gene Page: BRWD1

Summary
GeneID  54014
Symbol  BRWD1
Synonyms  C21orf107|FLJ43918|N143|WDR9
Description  bromodomain and WD repeat domain containing 1
See related  HGNC:12760|Ensembl:ENSG00000185658|HPRD:11683|
Locus tag  -
Gene type  protein-coding
Map location  21q22.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
ExpressionExpressionP value: 1.469 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0030528transcription regulator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
GO:0006357regulation of transcription from RNA polymerase II promoterIEA-
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA16780588 
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
SMARCA4BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2bSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4-HPRD12889071 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-12223152321m8hsa-miR-122aUGGAGUGUGACAAUGGUGUUUGU
miR-124.1873879m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5068728791A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-125/35190961Ahsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-130/301159165m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-132/2121441511A,m8hsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-181126132m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-1821972031Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-1868949001Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-19158164m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-200bc/429237243m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-23128134m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-26255025561Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-29227522821A,m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-30-5p4184251A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-3231281341Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-3761121191A,m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
miR-433-3p139145m8hsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
miR-78348401Ahsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
miR-961962031A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.