Gene Page: UBL3

Summary
GeneID  5412
Symbol  UBL3
Synonyms  DKFZp434K151|FLJ32018|HCG-1|PNSC1
Description  ubiquitin-like 3
See related  HGNC:12504|MIM:604711|Ensembl:ENSG00000122042|HPRD:05275|
Locus tag  -
Gene type  protein-coding
Map location  13q12-q13
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006464protein modification processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIDA11256614 
GO:0005886plasma membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.17557611Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-142-5p148014861Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-181155615631A,m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-19111211191A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-217148614931A,m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-323759765m8hsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-381153315391Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-383151715231Ahsa-miR-383brainAGAUCAGAAGGUGAUUGUGGCU
miR-44814841490m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-496155915651Ahsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.