Gene Page: CYCS

Summary
GeneID  54205
Symbol  CYCS
Synonyms  CYC|HCS
Description  cytochrome c, somatic
See related  HGNC:19986|MIM:123970|Ensembl:ENSG00000172115|HPRD:00479|
Locus tag  -
Gene type  protein-coding
Map location  7p15.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0044 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004722protein serine/threonine phosphatase activityTAS8206937 
GO:0005506iron ion bindingIEA-
GO:0005515protein bindingIPI9267021 
GO:0020037heme bindingTAS9515723 
GO:0045155electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activityIDA8689682 
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006309DNA fragmentation during apoptosisIMP8689682 
GO:0006810transportIEA-
GO:0006915apoptosisIDA8689682 
GO:0008635caspase activation via cytochrome cTAS9267021 
GO:0022900electron transport chainIEA-
GO:0045333cellular respirationTAS10383829 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000159protein phosphatase type 2A complexTAS8206937 
GO:0005634nucleusIDA11256614 
GO:0005739mitochondrionIEA-
GO:0005746mitochondrial respiratory chainIEA-
GO:0005758mitochondrial intermembrane spaceTAS8689682 
GO:0005759mitochondrial matrixIEA-
GO:0005829cytosolEXP9267021 |9390557 |9922454 
GO:0005829cytosolIMP8689682 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APAF1CED4 | DKFZp781B1145apoptotic peptidase activating factor 1-HPRD,BioGRID9267021|12147322 
BCL2Bcl-2B-cell CLL/lymphoma 2-HPRD10622714 
BCL2L1BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xSBCL2-like 1-HPRD,BioGRID9192670 
CASP9APAF-3 | APAF3 | CASPASE-9c | ICE-LAP6 | MCH6caspase 9, apoptosis-related cysteine peptidase-HPRD12147322 
COX4I2COX4 | COX4-2 | COX4B | COX4L2 | COXIV-2 | dJ857M17.2cytochrome c oxidase subunit IV isoform 2 (lung)Reconstituted ComplexBioGRID1309738 |6088481 
|10683230 |11737208 
-HPRD1309738 |2153405 
|6088481 |10683230 
|11737208 
CYB5ACYB5 | MCB5cytochrome b5 type A (microsomal)-HPRD,BioGRID199233 
CYB5R1B5R.1 | NQO3A2 | humb5R2cytochrome b5 reductase 1-HPRD9760250 
CYB5R3B5R | DIA1cytochrome b5 reductase 3-HPRD4403130 
CYC1UQCR4cytochrome c-1-HPRD,BioGRID6262312 
FDX1ADX | FDX | LOH11CR1Dferredoxin 1-HPRD6270113 
GSTK1GST13glutathione S-transferase kappa 1Affinity Capture-MSBioGRID17353931 
HSPA8HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71heat shock 70kDa protein 8-HPRD,BioGRID8663341 
HSPB1CMT2F | DKFZp586P1322 | HMN2B | HS.76067 | HSP27 | HSP28 | Hsp25 | SRP27heat shock 27kDa protein 1Affinity Capture-WesternBioGRID11784858 
NDOR1MGC138148 | NR1 | bA350O14.9NADPH dependent diflavin oxidoreductase 1-HPRD,BioGRID10625700 
SAFBDKFZp779C1727 | HAP | HET | SAFB1scaffold attachment factor B-HPRD11784858 
SNCAMGC110988 | NACP | PARK1 | PARK4 | PD1synuclein, alpha (non A4 component of amyloid precursor)-HPRD10506125 
UQCRC1D3S3191 | QCR1 | UQCR1ubiquinol-cytochrome c reductase core protein I-HPRD,BioGRID6251869 
VDAC1MGC111064 | PORIN | PORIN-31-HLvoltage-dependent anion channel 1-HPRD,BioGRID12243190 
VDAC2FLJ23841voltage-dependent anion channel 2-HPRD9615439 
 
KEGG Pathway Info
hsa04115: p53 signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04210: Apoptosis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05010: Alzheimer's disease - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05012: Parkinson's disease - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05014: Amyotrophic lateral sclerosis (ALS) - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05210: Colorectal cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05222: Small cell lung cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4103333391Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-433-3p961031A,m8hsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.